Some of my favorite crazies

1) The goth dyke that pukes in her (incongruently) sequined purse on the midnight CalTrain. Seen her twice so far, usually this happens on a Tuesday or Wednesday. You go gurl!

Is the purse a remnant from her life before she became a goth? Did she steal it from a sorostitute for the sole purpose of holding her vomit on the ride home? Cause that would make her my hero.

2) The cougar I keep running into at Safeway at 1AM. She is often dressed like she just got off work at the strip club, I swear to god I didn't know anyone could pair dayglow spandex miniskirts and various animal print (zebra, leopard, dalmation?!) hooker heels on a regular basis. Tonight she was painfully hitting on (like usual) the poorMexi-checker: "...That's what I tell my son. Who's in college. Goodnight Darlin'. "

At least she's owning it. Next time I promise photo documentation.

3) In my apartment complex, the yuppie dad who is father to "the screamer". A child who I thought was being bludgeoned with a wasp nest full of rusty nails, but apparently "just doesn't like riding in the car". Seriously, I have never heard a kid scream like that, the first couple times I thought about calling the police.

The same drama has unfolded multiple times: the father carries the screaming child towards the minivan. The child screams. The father tries to reason with said child for various amounts of time. Child still screams. Repeat ad naseum.

I hope the kid is autistic or has some nerve disorder. I've contemplated leaving a note on the winshield imploring them to seek counseling. Or maybe quit sodomizing their child in the minivan? I haven't decided yet.

4) Lenny, our upstairs neighbor from the house on Crestmere. World champion kickboxer (seriously), personal trainer, salsa dance instructor, loud porn enthusiast. Every day the salsa music would play for hours. Then quiet for a few moments. Cue the loud porn for about 5 minutes. Lather, rinse, repeat.

5) No one can top the crazy that lived next door at U-Place in CoMO. We called him the mathematician. He was a conspiracy theorist and watched FOX news and argued loudly with the TV every night. And he was a big crazy face mathematician. John Nash style, but on meth.

All of these crazy faces: "puking dyke", "Safeway cougar", "yuppie dad/screamer", Lenny, and the "mathematician" have made my life more interesting in their own way.

And for that I would like to say thank you.

I just found out that RepBase, a service of Genetic Information Research Institute, which I have been using for the past few months, is based in Mountain View.

A mile from my house off of Rengstorff, actually right next to Google.

RepBase is some bizarre database of repetitive elements, seemingly curated for free.

WTF.

Update: Agilent moved out of their office in Palo Alto, so Facebook moved in. I live within 5 miles of Google, Yahoo, Facebook, Pacific Biosciences, Affymetrix, and Roche.

Oh, and NASA's just down the street.

New kicks

Here is a list of the new things I'm obsessed with:

1) Madonna vs Lady Gaga vs Pitbull triple mashup. Epic.

2) Being at work for 24 hours straight, and then sleeping during the daylight.

3) These shoes:



Which are the blue version of these (which I have worn to tattered shreds):



Normally I try to avoid consumerism in all forms, but Gola knows my weak spot: shiny, bright-colored weapons of awesomeness.

4) Viruses that infected a wasp, have inserted themselves into the wasp nuclear genome, but then the wasp hijacked the viral protein for packaging of its own DNA which it injects into caterpillars to suppress the caterpillar's immune system so the wasp larvae can eat the host alive from the inside out. Also picking out completely unfeasible qualifying exam topics.

5) Verdi's Macbeth. Either the 1952 Callas La Scala or the 1976 Verrett La Scala version.

6) Visiting Mike and Jennifer in the city and then looking at Craigslist apartments in the Sunset and pretending that I am living there.

Went over to Jay and Lia's house with Diane tonight to help put together a rough sketch of a garden plan for their new backyard..while sipping a chardonnay. She knows how to make a gay happy!

Since everyone my age is a heathen, that eliminates religion from the politics-and-religion bipartite of impolite dinner conversation. Recently, it seems like I've been having the same conversation over and over. Namely, the definition of libertarianism. Words are words, but Jesus tap-dancing Christ. People might have more of a clue I said I am a closet Royalist (which I am). I concede to an extent terms like conservative, progressive, or reformist are all meaningless without a reference point. I think my commie hero Pete Seeger said it best:

"I like to say I'm more conservative than Goldwater. He just wanted to turn the clock back to when there was no income tax. I want to turn the clock back to when people lived in small villages and took care of each other."

Words are words, right? I'm trying to come up with a succinct one-liner that describes my fringe camp. It used to be "the party Party: you know, for legalization of drugs and elimination of taxes". I'm realizing it boils down to something less tangible: the dismantling of the nanny-state and the overthrow of American empiricism.

Two weeks from now marks the anniversary of my moving to NorCal. Until the day that I can live in NYC, I'll have to make do with San Fran...or 30 miles south of it...sigh. A west coast version of:

My little town blues are melting away, I'll make a brand new start of it, in old New York. If I can make it there, I'll make it anywhere!

Is my self satisfied delusion of grandeur vomit-inducing, or what?

Will my life be shaped by the rebellion against those little town blues? Will I never stop until I have a morphed into some pathetic hipster with super low V-necks, a fedora, squarish 80s sunglasses, who walks my dog in the Castro while holding hands with my boyfriend?

Actually, that doesn't sound that bad. Just no double stroller filled with ethnic babies bought with ipod bribes like in Bruno.

My 10 favorite famous people

Tina Turner (R&R singer/actress)
William Burroughs (homosexual writer)
Bette Davis (fierce actress)
Gregor Mendel (geneticist)
Barbara McClintock (geneticist)
Maria Callas (opera singer)
Charles Darwin (scientist)
Guiseppe Verdi (composer)Charles Ives (composer)
Deitrich Fischer-Dieskau (singer)
Francis Poulenc (composer)

Tosca, mi fai dimenticare Iddio!

Craig came into town for the weekend and here's what happened:

Friday: went to get Indian food and tried my best to die from an acute peanut allergic reaction. Forgot to give Craig the key and my phone is lost and his phone was dead, so I couldn't call him, so I sat in the ER waiting room while he ate ice cream outside my front door, until we finally met at 10PM. And by then, I just crawled in bed and tried to sleep off what felt like a stampede of water buffaloes across my stomach. Good times!

Saturday and Sunday we got to hang out and enjoying picnicking and brunch. Drank enough mimosas to awaken said water buffaloes and had to sleep off an impending hangover by the pool. What a hard life.

Monday: trip to San Francisco and the California Academy of Sciences (where nerds go to have fun), the musee mechanique (very touristy, but full of fabulously disturbing player pianos), tour a real retired WWII submarine in the harbor (just thinking about all those sweaty sailors stuck down there for 75 days made me want to have a smoke afterwards...and I don't smoke), go thrifting at the apty named thrift-town (where I got bambo shaped tumblers and matching blue willow patterned Japanese stoneware...recycle, reuse, reduce in action), and swing by El Farolito (my favorite hole-in-the-wall Mexican in the Mission).

Back in PA, we went to the Nut House (despite all my recent adverse peanut experiences) where Craig got to meet more of my grad school friends and get most of the way hammered.

All in all, a pretty fantastic birthday!

I also got to spend a lot of down time with my sweetest baby Craiger, reaffirming a love for my very own life-sized hunky ken-doll.

This week will be spent reading everything I can get my hands on concerning DNA replication timing, human repetitive elements, and nuclear compartmentalization. Yay for exciting science.

What will 24 have in store?

Is it time to quote Fried Green Tomatoes: "Face it girls, I'm older and have more insurance"?

Drinking and oath, and smutty jest

I haven't been this happy in a long time. I think I have finally settled in to the whole grad school thing, have a support net, still long to live in glamorous SF, etc.

The past couple months have been an extraordinary surge of (scientific) creativity and fulfillment. I can't remember the last time that I was this excited about science.

I have picked a thesis lab and start next week (after my birthday, the big 2-4).

And yet, a little of me is missing. My Craiger and my zipper are still living in Missouri, and although he is coming to visit this weekend, he will have to go back on Tuesday. When we finally live together, I wonder if I will appreciate it after being apart so long? Will I get used to coming home before it's dark every night? Will I get a motorcycle so I can keep up with by BF who is now officially a biker daddy?

One thing is for sure: I have found a group of friends that make me happy, and I hope I do the same for them. This weekend we hung out at an out-of-town profs house. Drinking ensued, and Lia and I may or may not have cross-dressed and posed with said professor's Lasker.

Creature of the night

My nocturnal state has once again reared its ugly head. The relative absence of classwork commitments coupled with my flexible hours as a scientist extraordinaire has caused my whole-sale shift from the diurnal schedule on which the rest of the world operates.

This has been a longstanding struggle. Ever since I was a child I was always a night owl. Recent experiments show that ex-vivo cell lines of extreme larks or night owls maintain their altered circadian rhythm as assayed by florescent reporters. So I am biologically justified in bizarre habit.

I always used to dream of becoming an entomologist that studied moths so I would have an excuse to stay up late. Watching Dave Attell's Insomniac proves conclusively that the late night folk are way more interesting anyway.

Today we will see if I can get back on track. Not so much out of necessity, but just out of principle. Here goes cold turkey: twitching, sweating, the whole nine yards.


Update: By the way, epic fail.

For God knows how long, I have been morbidly fascinated with LBJ and Lady Byrd.

Today as I picked out tomato, pepper, and tomatillo plants for my garden, I was reminded of Lady Byrd's fervent support of highway beautification saying, "And ahn evreh street coh-nuh, there woood be a shuh-rooob."

My grandpa lived through the Johnson administration, and always joked that highway beautification should be "riding with the top of the convertible up so no one would have to look at Lady Bird's ugly daughters".

The genteel Lady Bird was also a strong woman, one of the few who could reason with her heavy-handed husband. Against the wishes of LBJ, she used her inhertence to invest in radio and television stations in Texas, ammassing a $150 million dollar empire.

Playing second fiddle to Jackie Kennedy, devoted to her brutish and filandering husband, Lady Bird strikes a tragic yet stoic figure. Enduring the scorn of her contemporary liberals, Lady Bird--revisionist history notwithstanding--remains one of the most influential first ladies.

Despite their outdated gender construction, first ladies hold a special place in my heart. That's why Theresa Heinz Kerry would have never done: her eccentric accent and silk scarves were just too much for an America weaned on graciousness and accessibility.

Michelle Obama, seemingly overcoming her "strange mix of priviledge and victimology", has already won me over by planting a garden outside the Whitehouse. It's true, the path to my heart is through subsistence agriculture.

I used to think it was foolish to pander to Middle America: "We're just like anyone else, living in committed, monogamous relationships" or "We deserve the pursuit of happiness".

These arguments are intrinsically flawed because they seek the sanction of the heterosexual oppressors. I know I'm being dramatic, but did reasoning with the plantation owner emancipate the slaves? The "arc of justice"--it's now fashionable again to quote MLK--is usually steered by the courts not the electorate.

The more I think about it, I'm not sure if I like the direction of the contemporary LGBT movement.

Chasing after the double-strollered suburban dream somehow negates the long history of gay counter culture. I'm confused. Are we saying we want to be like everyone else, or we want everyone else to be like us?

When GLAAD protests the portrayals of lesbians in "Basic Instinct" or gay promiscuity in "Crusing" I want to stomp my feet and scream, "Who cares?!". When the day comes that dykes can't be sensual murderesses or fags can't be sweaty cock-fiends it's the day I get off this motherfucking train.

Supposedly, the movement dropped NAMBLA as a liability along the way. I guess distancing themselves from pedophiles served their purpose, but when will the assimilation stop?

The sad part? I would rather have gay marriage banned in all states immediately and see that mental midget with the plastic tits be the poster child of the intellectual meritocracy than have snivelling Perez Hilton be a flag bearer for the LGBT cause.

Opposite marriage indeed.

Walk. Now walk.

Yay for drinking mimosas at work on a Friday afternoon and then grinding worms while listening to RuPaul's "Cover Girl (Put the Bass in Your Walk)" when totally buzzed.

Later tonight we're having a Seder celebration (Go Jew Party!).

I love Stanford.

The atmosphere is very Macbeth-ish. What has, or is about to happen?

Just read an article about the United States Secretary of Education Arne Duncan.

The former CEO of Chicago's public schools, apparently tried his best to rescue the crumbling system with of all things (gasp!) accountability. Although short on specifics, the article details his approach of natural selection to weed out underperforming (PC speak for "shitty") schools. Not a popular choice with teacher's unions--who despite professing valuation of students' education, continue to openly sabotage even the smallest whiff of reform--the strategy is vaguely reminiscent of ermm...the free market.

I should quit my day job and become an oracle: Duncan--heavy on rhetoric and light on action--a mid-forties, attractive, glorified Chicago bureaucrat, Harvard grad (sound familiar yet?) will fail to deliver on 90% of his promises.

I'll be honest, I have a grudge against public (K-12) education. I had numerous excellent teachers in the small town I grew up in; I will always remember those that changed my life for the better: Jeff Sandquist (my choir teacher), Mary Wilkerson (my AP Calc teacher), Mrs. Hammond (my chemistry teacher), Mrs. Ewing (my American Lit teacher). I was more fortunate than inner city Chicago kids.

But most of my time from the age of 5 to 18 was wasted by ineffective, incompetent, uninspired, and uninspiring lifers. These are the parasites that make up the bulk of teachers' unions.

As of late I have recessed from a rabid fascination with politics and public policy. It makes my blood boil to think about how the faux distinct Republidemocrats are flushing my beloved country down the toilet with their imperialism and grandiose redistribution of wealth.

My instinct is to play the violin as Rome burns, but something is amiss.

I finally put my finger on it. From far away, the farce called America provides better entertainment than RuPaul's Drag Race. Close up, it's too grotesque to watch.

[Edit: Thank god for Iowa?! I never thought I would say that.]

Utterly disturbing realization #586,359

Young Stalin was hot! Look at Miss Joseph work that scarf and Guido hair!

At this point he was a 5'4", pockmarked, former seminary student and soon-to-be pretty criminal. Destined to be arguably the worst mass murderer--at least most prolific--in world history, this picture of the devil himself demonstrates that ugly things can come in (small) and pretty packages.

Slap a pair of X-ist briefs on this 24-year old Uncle Joe and he could go work for Michael Lucas.

Cher: Would you call me shallow? Dion: No. Not to your face.

Shopping for clothes: Cher from Clueless:: Shopping for antibodies: Me.

How much of a nerd am I?

Abcam, Novus, Upstate (now owned by Millipore, who knew?) have made me want to go into biotech instead of academia.

Dolla, Dolla billz, y'all.

I have meaning to write about this for a long time...but never could really bring myself to actually do a post about Michael Lucas.

He's the bratty child in the grocery store who throws a foot-stomping tantrum. And instead of his yuppie mother leaning over and politely asking him to share his feelings, she should unwaveringly bludgeon him with the nearest piece of produce, ideally a unripe pineapple.

Giving him any attention and then lamenting his overexposure (pun definitely intended) is a delicate tightrope act, so I'll do my best.

For those of you who don't know, Michael Lucas is a gay porn kingpin originally from mother Russia, but currently based in NYC. I have read his blog (warning NSFW, read: this means you Bees!) with eagerness for about four years. Never one to miss even the most banal opportunity for publicity, Michael without fail posts links to the various D-list magazines willing to stoop low enough to interview him..and usually take pictures of his disgusting dick/him wearing high-end fashion designed to distract us from his Zoolander lips.

From Michael I learned about anal douching, the dangers of barebacking, the safety of oral cumshots, and a slew of other non-porn related topics.

Believe it or not, the most interesting part of reading his blog is learning about his political views. He is so refreshingly un-PC-- in a world full of queens watching what they say at every turn, it is nice to have some frankly offensive "straight" talk. Most of Michael's political views are driven by his unashamed support of all things Israel and his uncompromising gay agenda.

As I remember, he was very tough on Hillary Clinton, the seemingly unchallenged darling of the LBGT community during the 2008 presidential farce race. Hillary is the ultimate two-faced Janus of a politician, and Michael calling her out on cockteasing the queer electorate won him points in my book.

I cannot tell you how hard I laughed when I read his interpretation of California's passing of prop 8 in an entry entitled The Mormon-Black Axis of Hate. Provocateur or serious? You be the judge.

Always one to use his perspective as an immigrant from the crumbling Soviet Union, Michael often comments on US fiscal policy:

All of this government “help” is making me concerned that this country is moving towards socialism, which I so happily escaped. The government is not your loving mother who will come and rescue you from any situation you've put yourself in.

Jumping at any chance to slam Islam, Iran, or Saudia Arabia, Michael never lets anyone forget that he's a Jew. And that homosexuals are discriminated against and often executed throughout the middle east, Israel being the shining exception.

But what is the real reason that anyone puts up with all his self-aggrandizing vitriol? He's holding daddly-licious Wilfried Knight hostage.



Nevertheless, I find Michael's blog captivating, reading it with bated breath everyday like a jury looking at autopsy photos through spread finders.

When he's ready to brunch with me and discuss coming out of the closet as a fiscal conservative, I'll be waiting.

Glück das mir verblieb

What a fantastic whirlwind the past few days have been.

Last week was the last "real" week of the quarter. The perl continued to eat my soul to the very end. The last few days before my project was due were spent lying in bed (like some Victorian invalid) , surrounded by tea service, curtains drawn, continuously coding.

But it is done, and as soon as I finished, the jagged and strident circus music--as if piped through a tin can directly into my atrophied brain--stopped.

On Sunday, to my delight, I went barrel tasting with Lia, Jay, Biff, Jan, et al to Sonoma. Needless to say the escape from the utter monotony of pedestrian faux-chic Palo Alto was appreciated. A wonderful day spent in the NorCal countryside sipping ports, merlots, cab savs, and pinots. Totally burned out on red wine for the time being.

Despite a rather bizarre day on campus, two facts remain: the in vitro chromatin assembly worked, and I'm fuckitty-fucking done with genomics!

Craig is visiting/job-hunting next week, so I will get to see my baby and enjoy spring break.

Dolly Parton and Jennifer Holliday make life worth living.

I had a really good day today. That is all.

head full of straw

Fuck you perl! Why is this so hard?

I want to join an array composed of sequence that I split based on position within the array. I spent the last two hours figuring out how to do this, and this is all I came up with. It works, but Jesus:

#!/usr/bin/perl

use strict;
use warnings;

my $seq = qw(GGGCCGGCTCGCGGGCGCTGCCAGTCTCGGGCGGCGGTGTCCGGCGCG
CGGGCGGCCTGCTGGGCGGGCTGAAGGGTTAGCGGAGCACGGGCAAGGCG
GAGAGTGACGGAGTCGGCGAGCCCCCGCGGCGACAGGTTCTCTACTTAAAA
GACAATGACTACTGATGAAGGTGCCAAGAACAATGAAGAAAGCCCCACAGC
CACTGTTGCTGAGCAGGGAGAGGATATTACCTCCAAAAAAGACAGGGGAGT
ATTAAAGATTGTCAAAAGAGTGGGGAATGGTGAGGAAACGCCGATGATTGG
AGACAAAGTTTATGTCCATTACAAAGGAAAATTGTCAAATGGAAAGAAGTTT
GATTCCAGTCATGATAGAAATGAACCATTTGTCTTTAGTCTTGGCAAAGGCC
AAGTCATCAAGGCATGGGACATTGGGGTGGCTACCATGAAGAAAGGAGAGA
TATGCCATTTACTGTGCAAACCAGAATATGCATATGGCTCGGCTGGCAGTCT
CCCTAAAATTCCCTCGAATGCAACTCTCTTTTTTGAGATTGAGCTCCTTGATT
TCAAAGGAGAGGATTTATTTGAAGATGGAGGCATTATCCGGAGAACCAAACG
GAAAGGAGAGGGATATTCAAATCCAAACGAAGGAGCAACAGTAGAAATCCA
CCTGGAAGGCCGCTGTGGTGGAAGGATGTTTGACTGCAGAGATGTGGCATT
CACTGTGGGCGAAGGAGAAGACCACGACATTCCAATTGGAATTGACAAAGC
TCTGGAGAAAATGCAGCGGGAAGAACAATGTATTTTATATCTTGGACCAAGA
TATGGTTTTGGAGAGGCAGGGAAGCCTAAATTTGGCATTGAACCTAATGCTG
AGCTTATATATGAAGTTACACTTAAGAGCTTCGAAAAGGCCAAAGAATCCTG
GGAGATGGATACCAAAGAAAAATTGGAGCAGGCTGCCATTGTCAAAGAGAA
GGGAACCGTATACTTCAAGGGAGGCAAATACATGCAGGCGGTGATTCAGTAT
GGGAAGATAGTGTCCTGGTTAGAGATGGAATATGGTTTATCAGAAAAGGAAT
CGAAAGCTTCTGAATCATTTCTCCTTGCTGCCTTTCTGAACCTGGCCATGTGC
TACCTGAAGCTTAGAGAATACACCAAAGCTGTTGAATGCTGTGACAAGGCCC
TTGGACTGGACAGTGCCAATGAGAAAGGCTTGTATAGGAGGGGTGAAGCCC
AGCTGCTCATGAACGAGTTTGAGTCAGCCAAGGGTGACTTTGAGAAAGTGCT
GGAAGTAAACCCCCAGAATAAGGCTGCAAGACTGCAGATCTCCATGTGCCAG
AAAAAGGCCAAGGAGCACAACGAGCGGGACCGCAGGATATACGCCAACATG
TTCAAGAAGTTTGCAGAGCAGGATGCCAAGGAAGAGGCCAATAAAGCAATGG
GCAAGAAGACTTCAGAAGGGGTCACTAATGAAAAAGGAACAGACAGTCAAGC
AATGGAAGAAGAGAAACCTGAGGGCCACGTATGACGCCACGCCAAGGAGGG
AAGAGTCCCAGTGAACTCGGCCCCTCCTCAATGGGCTTTCCCCCAACTCAGG
ACAGAACAGTGTTTAATGTAAAGTTTGTTATAGTCTATGTGATTCTGGAAGCA
AATGGCAAAACCAGTAGCTTCCCAAAAACAGCCCCCCTGCTGCTGCCCGGAG
GGTTCACTGAGGGGTGGCACGGGACCACTCCAGGTGGAACAAACAGAAATGA
CTGTGGTGTGGAGGGAGTGAGCCAGCAGCTTAAGTCCAGCTCATTTCAGTTT
CTATCAACCTTCAAGTATCCAATTCAGGGTCCCTGGAGATCATCCTAACAATG
TGGGGCTGTTAGGTTTTACCTTTGAACTTTCATAGCACTGCAGAAACCTTTTA
AAAAAAAATGCTTCATGAATTTCTCCTTTCCTACAGTTGGGTAGGGTAGGGGA
AGGAGGATAAGCTTTTGTTTTTTAAATGACTGAAGTGCTATAAATGTAGTCTG
TTGCATTTTTAACCAACAGAACCCACAGTAGAGGGGTCTCATGTCTCCCCAGT
TCCACAGCAGTGTCACAGACGTGAAAGCCAGAACCTCAGAGGCCACTTGCTT
GCTGACTTAGCCTCCTCCCAAAGTCCCCCTCCTCAGCCAGCCTCCTTGTGAGA
GTGGCTTTCTACCACACACAGCCTGTCCCTGGGGGAGTAATTCTGTCATTCCT
AAAACACCCTTCAGCAATGATAATGAGCAGATGAGAGTTTCTGGATTAGCTTT
TCCTATTTTCGATGAAGTTCTGAGATACTGAAATGTGAAAAGAGCAATCAGAA
TTGTGCTTTTTCTCCCCTCCTCTATTCCTTTTAGGGAATAATATTCAATACACA
GTACTTCCTCCCAGCATTGCTACTGCTCAGCTTCTTCTTTCATTCTAATCCTTG
CTATTAAGAATTTAAGACTTGTGCTTACAATATTTTTGACCTGGAGTGGATCT
ATTTACATAGTCATTTAGGATCCATGCAGCTTTTTTTGTCTTTTTAAGATTATT
GGCTCATAAGCATATGTATACTGGTTTATGGAACTTTATTTACACTCCTCTATC
ATGCAAAAAAATTTTGACTTTTTAGTACTAAGCTTAATTTTTAAAAACAAAATC
TGTAGTGTTGACAAATAAATAGTTGCTCTTCTACACTAGGGGTTTCACCTGCA
GGTTTGACACGCAGTTGCTCGCTTTTCCTGCCCTGTCAAGCTTCTCTGTTCTG
GCGTGAGTTGTGAAAGAGTTGAAGACAGCTTCCCATGCCGGTACACAGCCAG
TAGCCTAAATCTCCAGTACTTGAGCTGACCATTGAACTAGGGCAAGTCTTAAA
TGTGTACATGTAGTTGAATTTCAGTCCTTACGGGTAAACAGATTGAGCATGGC
TCTCTATTCCCTCAGCCTAAGAAACACTCATGGGAATGCATTTGGCAACCCAA
GGAACCATTTGCTTAAACCTGGAACATCTCACCTTTTTAAATCCTAAAAAACA
CTGGCAGTTATATTTTAAATTAGTTTTTATTTTTATGATGGTTTTATCAAAAGA
CTTTTATTATTAGATTGGGACCCCCTTCAAACCTAAAAATCAAGTTATTTCCTT
TTATAATACTTTTCTTCCCCATGGAACAAATGGGATCAATTTGTGAGTTTTTTC
CTTTAATGATAACTAAAATCCCTCTAATTTCTCATTTATGCTTTTGTCTTTTTTA
TGAAATATTTCTTTTAAAAGCCCCAGTCTCACCTACGAAATATGAAGAGCAAA
AGCTGATTTTGCTTACTTGCTAAACTGTTGGGAAAGCTCTGTAGAGCATGGTT
CCAGTGAGGCCAAGATTGAAATTTGATACTAAAAAGGCCACCTAGCTTTTTGC
AGATAACAAACAAGAAAGCTATTCCAAGACTCAGATGATGCCAGCTGTCTCCC
ACGTGTGTATTATGGTTCACCAGGGGGAACTGGCAAAAGTGTGTGTGGGGAG
GGGAAGGGTGTGTGAGTGGTTCTGAGCAAATAACTACAGGGTGCCCATTACC
ACTCAAGAAGACACTTCACGTATTCTTGTATCAAATTCAATAATCTTAAACAAT
TTGTGTAGAAGTCCACAGACATCTTTCAACCACCTTTTAGGCTGCATATGGAT
TGCCAAGTCAGCATATGAGGAATTAAAGACATTGTTTTTAAAAAAAAAAAATC
ATTTAGATGCACTTTTTTGTGTGTTCTTTAAATAAATCCAAAAAAAATGTGAAA
AAAAAAA);


my @x = split //, $seq;

my $exon_breaks= "0,133,257,402,545,660,817,908,992,1178,1418,3770";

my @y = split (/,/, $exon_breaks);


sub get_exon_sequence{

my @array = ($y[0]..$y[1]);

my $exon = join "", @x[@array];

print "$exon \n";

shift @y;

}

until($y[1] eq undef){&get_exon_sequence};

Lots of people that suck

So this semester I'm taking genomics, which is cool. But we have to learn perl. Which is also cool.

Except I have no programming experience, and this is a trial-by-fire if there ever was one.

Things are going well so far, I'm just so slow. Every day is an exercise in humility.

The good news? I'm talking to Alan a lot more. He's boss.

Here's a classical "alanism" from tonight:

i'm starting to rethink that - the midwest has its perks,

like friends

normal life

green grass

lots of people that suck, so you look cooler.

****

Two weekends ago I got to see Dimitri Hvorostovsky in SF.

I was happier than Nancy Grace after finding out that the Jon Benet Ramsey case was reopened.

Hvorostovsky did a program of Tchaikovsky, Medtner, and Rachmaninoff lied. I didn't really care for the Tchaikovsky, but the Medtner alone was worth the price of admission ($70).

His sublime legato made it seem like a ventriloquist was singing the consonants. A+.

Much needed Berg-induced silliness, last night.

Today: caffeine-induced productivity--sitting in coffee-zone, in my beloved yet-estranged Columbia, reading interesting science and listening to Maria. Rachel always said that seemingly-profound realizations had while smoking pot decay like rotting fruit in a Peter Lynch film during the day after.

You wake up in the harsh morning light and the severe yellow-green rays of the sun reveal your foolishness like an unflattering shadow on the melancholy face of a Van Gogh.

Living in the moment? Simple pleasures? My excitement and inquisitiveness are returning after weeks of apathy and suppression.

I'm finally feeling back to normal after the nightmarish fall (cue the strident tritone double stops of a Saint Saëns violin and a staggeringly drunk Lindsey Lang, hair askew, shot in a jarring Dutch tilt).

Craig says that Mozart is the Britney Spears of classical music. I usually agree, but Entführung has some sublime moments. Overly-stylized and musically fluffy, but sublime nonetheless.

What will 2009 hold?

What a nice baby I have! Puts up with crabby-Ed and sends me adorable-as-all-get-out (that was my best Sarah Palin) pictures of zipper (too sexy, think of the children) to cheer me up. Enjoy.

Sola. Perduta. Abbandonata.

Cosa si può dire?

Now that I am totally unpacked, my life has been (pleasantly) occupied with the mundane.

I ventured out into the world today to get a 3-hole-punch (so I can organize my binders of literature that have piled up over the last 4 years), a swingline stapler (but, the squirrels), a food processor (for the soup making), a beater/mixer set (for the imminent baking), and various other necessities.

I always tried to collect kitchen ware that was multifunctional and I could glean from a Goodwill or Salvation Army. Garlic presses, salad spinners, and cake-frosters need not apply. My only downfall to date is my juicer...a fortuitous, invaluable, and thoughtful gift from my Craigers.

I am enjoying planning meals, and perusing my cookbooks for new ideas. I think I am going to make beet soup with mascarpone brioche tomorrow.

The rest of my day was spent procrastinating, then starting, then procrastinating some more on the manuscript preparation. I am setting a goal of 6 hours of work tomorrow, and come hell or high water, it's gonna happen.

Last night I watched a documentary called "Escape from suburbia" that fleshes out, in great detail, the impending energy crisis caused by peak-oil. The urban-centered economies require transport of everything from food, water, energy, and a workforce. For a smaller metro area, this seems feasible; for places like LA, with no public transport to speak of, an influx of millions of workers to the city each day seems like an epic waste of time and energy.

It was easy to get tidal-washed with the "Inconvenient Truth"-style pandemonium of crisis-mongering, pedantic, pathetique-but the documentary actually offered some concrete solutions to the energy conundrum.

1) Subsistence agriculture has been in style for thousands of years, for one reason: food grown locally is more healthy and requires no/little transportation cost. Apart from very urbanized areas, each person in America has the capacity and ability to grow a container garden. In Missouri, I used most of the back yard for permaculture, but I realize that is not possible everywhere. In many places in Europe, families have a garden plot either next to their house (or on their roof). I think this issue really boils down to space utilization, and the unwillingness of lawn-happy, delusional yuppies to sacrifice the status symbol of manicured grass.

2) Commutes. Why? Suburban communities can create their own local economies instead of serving as the rabbit hutches for the consumer-culture zombie-fied proletariat.

3) Alternative energy. Surprisingly, the filmmakers gave this movement little credence. The fallacy that biofuels, wind, solar, and geothermal power can replace the use of fossil fuels has been perpetuated by a government that has the central goal of pacification. According to the movie, the global (read: American) society has to change it's habits before any alternative energy strategies can even make a dent in our consumption.

So what have I learned? Subsistence agriculture is always in vogue, commute as little as possible and if necessary, bike or ride public transportation. Live sustainably when ever possible. Renewable energy sources are great, but not sufficient to support our consumption rate. The government (at least the federal and state) are impervious to the drastic corrections that need occur--so deal with the city, town, or community government if you feel the need for some activism.

It's not about being "green", politically correct, or fashionable. Eco-friendly is the closest descriptor I can pick without vomiting a little in mouth.

We've veni'd and vidi'd, now its time we vici'd.

Next time: my thoughts on Scarpia, Rigoletto, Iago, Count Almaviva, and why the baritone villain is always my favorite character.

I'm moved in.

Ed=the conqueror.

Amuhrica, FUCK YEAH

Don't want to jinx it, but I may have some very exciting news to post about this evening.

That is all.

Go to the field on weekdays, have a picnic on Laborday

So I am pretty much completely obsessed with Tina Turner. I'm planning a post about the parallels between TT and Maria Callas. I don't use the F word lightly, but they are both so fierce. (I will have to watch Mad Max: Beyond Thunderdome yet again.)

But, after all, I do need some frenetic TT to get me through the last week in the Cone lab, which shaped up to be a non-stop shit-show, cluster-fuck. I was trying to finish up some last experiments so that I wouldn't have to get my coworkers to find my 4.5-years of unorganized supplies while I am 2000 miles away. So, we did finish most of the field work (I think) and I am finishing up the last experiments as we speak. So to say.

I have slept 5 hours in the last 48, but for some reason I am still going strong. Here's why: I've found that by staying out of the daylight, I can totally subvert my body's natural circadian clock. I actually caught myself purposefully not looking out the window at work today so that I would fool myself into experiencing perpetual night.

I know. That is so vampire-emo.

Some nerdery:

One of the last experiments I am doing is a real-time RT-PCR, which is a pretty powerful (if not standard) genetic technique. Basically you make cDNA from a RNA sample, and then carry out PCR with the cDNA to quantify the transcript level. Sounds pretty simple right?

In theory. But of course as Homer Simpson likes to say, "In theory communism works."

So you have to flash freeze your tissues in liq N2, grind them, extract them with trizol (that helps keep the RNases from chewing up your nucleic acids), chloroform extract the trizol, precipitate the RNA with isopropanol and salt, wash the RNA with EtOH, and resuspend it back up in DEPC H20. After each step you have to centrifuge, and remove the supernatant with a Pasteur pipette.

To keep from getting the reverse transcriptase from extending any genomic DNA contamination, and therefore negating your RNA quantification, you have to then digest your total RNA sample with DNase I, then phenol:chloroform: isoamyl-alcohol extract, and resuspend.

Then you need to carry out the RT rxn with MMLV (monkey murine reverse transcriptase), RNase inhibitor, dNTPs--then PCI extract the first strand cDNA, use spectrophotometry to determine absorbancy, and then run real time PCR in technical triplicate with endogenous controls to quantify RNA levels. I won't even go into the primer design phase, but those have to be gene-specific and optimized separately.

Ideally you would assay the integrity of your RNA and then check for inhibitors of the qPCR rxn. On a formaldehyde (denaturing gel).

The real-time PCR uses florescence to quantify the accumulation of double stranded products in real time; by including a passive reference dye and SYBR green (which binds to double stranded DNA) you can measure product after each of the 40 cycles.

I know. Pretty ridiculous, right? Considering that I didn't know how to do any of this about 5 weeks ago, I think I am doing OK.

What's next?

Considering that I've barely started on manuscript preparation, I have to somehow copy most of my lab notebooks from the last 4.5 years, and take my shitload of files.

Did I mention that I am leaving on Tuesday morning?

I plan on packing Sunday and Monday. That will be fun and exciting.

Go westward young man.

It has finally hit me that I am starting a completely new life in a state 2000 miles away where I know a handful of people. I will miss Craig and zipper so much! Not to mention the other Columbia friends L&K, Rachel, etc.

Sorry that was totally rambling, and probably mostly incoherent, but I am about to nod off into a coma for the ages, so gentle reader...goodbye for now.

Today I just couldn't take the mounting pressure of the end of the summer blues. Finishing up all the experiments at work, writing the manuscript, making sure Stanford gets all my paperwork (tuberculosis test!?), arranging logistics for the 1,920 mile trip to Palo Alto--all without knowing where I am going to live yet--is weighing heavily on me.

Got to cook some tonight, I'm trying to use all the food I planted. That was fun. Yay for volunteer lemon basil, now If I could only tell when my green zebras were ripe...

Watched some of the Olympics again tonight. Spoiler Alert!

Even though going 1-2-3 in the men's 400 and 2-3 in the 110 highs, the crumpling of both the 4X100 teams put me in a bad mood. O cette ennui bleu dans le coeur.

Rachel and I finished the night by drinking plum-blueberry-lime smoothies and watching the US get gold in the men's beach VB. America! Fuck yeah!

I know that everything will be ok, and in the long run my worrying is unfounded and unproductive. Headline: Neurotic, ex-Lutheran, gay scientist, opera singer dies of stress-induced heart attack at 23.

But as Scarlett said, "Tomarrah is anotha day."

Peoples of the earth, you have all been poisoned

Lest you, gentle reader, think that I have one whole brain, here's this:

Deejy-weejy and I came up with the gay decathlon:
1) Dressing
2) Activism
3) Gossiping
4) Underwear modeling
5) Oral sex
6) Dancing
7) Cooking
8) Sashaying
9) Hagging
10) Madonna/Tina/Whitney/Cher/Kylie/Dolly Karaoke-ing

Had a wonderful B-day.
Got to go to Ha-Ha Tonka (a made-up Indian name) with riveting company and see castle ruins, the spring, some caves (which were closed), and hiking. Also a decadent picnic. Then on to swimming and Indian food and then Sparkys. It was a fantastic and relaxing Saturday.

Sunday was spent recovering. Lots of sleeping in, gardening, dog-parking, phone-talking, and spending time with my baby Zipper and his owner Craigers.

Went to rehearsal tonight for POP and then I'm working on reading some "fun" summer reading. I'm on about 4 books at the same time. Here's what I've learned so far:

Alan Greenspan, The Age of Turbulence. Yes, he was the puppetmaster. No, I still don't get economics.

Burroughs, The Nova Express. Doing heroin and writing about gay sex leads to multiple-page ruminations about centipedes, ejaculate, and talking bugs. The Western Lands and Naked Lunch were basically the same thing.

Learning Perl. I am a complete retard and will never learn to program.

Tolstoy, Anna Karenina, 457/839. I totally understand why the peasants had to revolt and murder the milquetoast aristocracy in their sleep. I reject your bourgeoisie values, the wheels of the revolution will crush you.

O nature green unnatural mother

As I squatted dirty faced and bug spray perfumed over my legume garden this weekend, hand feeding freshly-picked snow peas into mouth, again hand feeding freshly-picked snow peas into mouth like some hunched intently focused chimpanzee slurping ants off a twig, I contemplated my opportunity for creative self-actualization.

For the past 5 years science and singing have been like rather, rinse, repeat--my sole source of fulfillment and satisfaction.

I have been taking a hiatus from singing for the last month (which might change with a chorus part in G&S's P.O.P.) to concentrate on other things.

Namely, chilling out and exercising. And gardening.

I have several plots with various themes. There is the eggplant, various peppers and tomatillo plot X2. There is the exotic tomato plot, the hybrid tomato plot, the heirloom tomato plot, the exotic leaf and head lettuce/spring garden plot, the spindly cucurbit plot. Also the 2 culinary herb plots and the aforementioned legume plot. Of course who could forget the annual bed consisting of zinnia, aster, cosmos, marigold, salvia?

I like growing things. I like being dirty.

Is this a distraction from my destiny? i thought as I sipped freshly brewed mint tea as the bruised mint so garishly green in the scalding water, released bits of floating leaf into my mouth at 9:30 PM as the last blue twilight disappeared and grass blended into my hands blended into the empty seed packets blended into that gray-blue before the real night lit by the moon takes over.

So much guilt.

When life opens its little raincloud of shittiness, I try to concentrate on the positive things and not let pettiness run my life.

I am so fortunate! I am young and beautiful, have amazing friends, a loving, gorgeous bf, am going the land of milk-and-honey next year for grad school. (I'm humble too.)

Insert Cher, "Ugh, you are a snob and a half."

So anyway, I'm planting this enormous garden this year, and putting in some "island of misfit toys" stuff: green zebra tomatoes, and black crimean tomatoes (they look like a big bruise). Also: 4 kinds of basil, a flower garden, an herb garden, and a cucurbit patch.

Tonight I had a radish top, granny smith apple, Parmesan cheese, lemon juice and balsamic vinaigrette salad. All in all, it was a pretty life-affirming experience.

Now I'm back off to work, practice, the gym, then home to transpose some Sibelius, and bask in the fact that yes, indeed I already graduated and don't have to worry about school (until Sept 22).

Le sigh.

Tranced, fanatical they shrieked and sang

I've been toying around with the idea of singing Ives' song "General William Booth Enters into Heaven" for my upcoming recital this summer. The song is a huge mess: multiple musical quotations, the occasional 4.5/4 bar, a hefty vocal line (including an Ab), not to mention the singer has to compete with a typical Ives "elbow" chord peppered accompaniment.

Where would one get the inspiration for a 5 minute religious revival?

One of the best movies ever.

That's right, Elmer Gantry.

Charlatan doesn't begin to describe Burt's character...it was probably the turning point in my childhood that distorted my view of any "man of god" into a degenerate snake-oil salesman.

Elmer Gantry was a typical role for Burt. He only ever played the alpha male, a hyper-masculine sexpot. Like an ape in a suit (Sorry, Wrong Number is perhaps the most conspicuous example), his animal magnetism was so raw you had to watch it through spread fingers, like a jury looking at autopsy photos.

Look out!

From the great state of California

So much has been happening lately that I can't keep up.

1. I graduated from college (2 degrees suma cum laude). I was also the banner bearer at the A&S graduation --to my horror and my mother's elation--so a throughly embarrassing experience was had by all.

2. I went to Puerto Rico for 3 weeks during January for the winter nursery, and Craigers got to come for a week on the cheap. I should have some posts about that, but the internet down there (in the south, aka the poor part of the island) was ridiculous. Had lots of fun, but was so ready to come back.

3. Grad school: I got interviews at Duke, Stanford, UC-Berkeley, UCLA, Emory, and Wash-U. So far I've been accepted to Harvard genetics and Duke genetics/genomics.

4. I am in California for 9 days (suck it Missouri!) to visit UC-Berkeley and Stanford, so I'm really excited about that. If MBK wants to come and rescue me from the nerdery and show me a good time in SF, I wouldn't complain.

5. I am missing the maize meeting (boo whore) but I am doing some really cool research at work. I'm sure I'll eventually get around to posting something about that. I was super freaked about my plants and when they are going to time out in the greenhouse, etc, but I think all that crap will work itself out.

6. I am putting together one crazy recital with RA. Tentative date is going to be late spring, and I'm doing the Wolf Harfenspeiler, Chausson Serres Chaudes, a Sibelius set, an Ives set, and probably arias from Il Dulca D'alba and Eugene Onegin. I'll put together a post about all that crazy lit, but it looks like for now that I'll be singing in 6 languages. Seriously, whiskey tango foxtrot.

7. I am doing a one act opera called Three Sisters Who are Not Sisters by Ned Rorem. The libretto is by Gertrude Stein, so you can imagine the inane-ity to ensue. Right now, we are going to do it as a student production--so that means that we will have to find funding, performance venue, do the staging-costuming-lighting, organize rehearsals, etc. I'm post later about this, but I expect it to be crazy like a fox.

I also plan to do some posts about Sarkozy, Slava Mogutin, Maeterlinck, and my latest thoughts on Bette Davis.

TTYL chaches.

I'm a murderer.

I killed a mouse with my bare hands Thursday night, put it in a Shakespeare's cup and threw its seizing body out the front door. I didn't feel the least bit guilty--at the time--because:

1) It was loud and slow. Being Darwin's handmaiden is an ugly job, but someone has to do it. I am just Jules striking "down upon thee great vengeance and furious anger".

2) While I am far from being a neat housekeeper (all those threats of cleanliness imbuing godliness), a mouse crapping in my house was too much of an affront to my pride.

I had initially toyed with the idea of buying a live trap, but I guess this is the last nail in the coffin of my compassionate conservatism.

Where does this bloodlust originate? I may have inherited it:

When I was home one weekend, my father beat an armadillo (that had been eating the salad greens from the garden) to death with a baseball bat in our backyard while my horrified sisters and I watched. It bounced at least 2 feet off the ground.

Man of action indeed!

The Immolation scene from Götterdämmerung is lofty background music for my midnight biscotti making, but who can resist a good multi-tasking opportunity?

Don't you love how letting your mind wander at 2AM can resolve hitherto unarticulated aversions?

Crewcut sporting lesbians, invariably standing on courthouse steps dressed in pantsuits, have been a fixture of gay-marriage debate for as long as I can remember. I concede that they have a vested interest in the struggle, as a biological clock (the main impetus for seeking "equality") seems to not discriminate on the basis of sexual orientation. To each her own.

My repulsion by the side-show comedy that is the same-sex-marriage debate was caused by something more sinister than the "morally-bankrupt heterosexual institution" tripe. And thanks to Florence King, I finally have figured out how I feel.

I might as well have said, "I don't want to get married, I'd rather live in Paris and have affairs like George Sand."

I CAN'T WAIT TO GRADUATE.

I'm so close. Seriously, so close.

Continuing in our long line of costumes in *poor* taste, here's a Halloween recap y'all.
05: Batman and Robin
06: Pitcher and catcher
07: Priest and altar boy

Last weekend was spent at NATS and associated activities. Besides staying at a hotel that was hosting a blind person convention, I spent time with the real crazies: singers.

I am also wrapping up a NSF GRFP application, studying for the GRE, and gearing up for the fun that is filling out grad applications.

Time will tell what becomes of all this crap.

I also realized what is up with my tomatoes. Apparently, I didn't really follow my carefully drawn map, because what I thought were brandywines were actually yellow boy hybrids. So that's why they started rotting after turning a light orangish. Hmm. So today I picked a basket of tomatoes (in November!) and made what might be the last feta, EVOO, tomato, kalamati olive, and lemon basil salad of the fall. Sigh.

My garden was a productive and therapeutic experience, and I plan to increase the plots next spring. In addition to a cutting garden with more herbs, I want to put in some cucurbits and other fruit (blackberries, strawberries?). Ack! How will I make it through winter?

In other horizons, Craiger and I are excited about the live (in HD!) Met broadcasts that will finally come to Columbia. Going to Met on a regular basis would be a luxury that I will probably never be able to afford, but this is almost as good right?

What does one wear to an opera broadcast? Are the exotic-bird plumages still required?

Living life as one big resume-building experience gets old. I have begun seeing people as commodities/tools to be optimized and exploited. Is this normal?

I'm currently knee-deep in the NSF GRFP application...I'm proposing a rather ambitious project to elucidate paramutation mechanisms (Lit reviews are more fun than homework). I guess it's a good sign that I really enjoy this part, being as it's what I am going to do for a living, haha.

A portrait of my mind at the end of its tether: every time I think about how many things are on my to-do list, I envision Ursula singing "I'm a very busy person and I haven't got all day!"

Disney allusions: the ultimate litmus test for insanity. Or as Michael J Budds would say, (referring to Joan Sutherland as Lucia) "she's nuttier than a fruitcake!"

A more mundane tid-bit: I made salmon cakes with some grated zucchini, yellow squash, lemon juice, pepper, and fresh tarragon from my garden. Yum!

Happenstance:

Right now, there are three (3) construction worker-types (with chain saws and toolbelts, oh my!) in my backyard cutting down branches from around the telephone lines.

The kicker: none of them are as beefy as my boyfriend.

And I would really rather just take a nap.

Ok. I'll just say it.

I am obsessed with Strauss' Elektra. Craig and I checked out the DVD and watched it a couple of weeks ago (The 1989 Eva Marton Vienna Staatsoper). Most of the scenes can also be found on youtube.

It can be angular yet voluptuous--and Eva Marton is a beast...basically it requires shouting for two hours over a full orchestra with constant brass.

The opening line "Allein! Weh, ganz allein" gets me every time.

Things that make Ed happy:

1) Only having one class tomorrow (at 8AM though, boo)
2) Finishing some fine mapping tomorrow at work
3) No opera rehearsal
4) Going to the batting cages with Craig tonight

Hello, gentle reader. I emerge from my chrysalis of blogging seclusion to bring you this tid-bit:

Every once in a while I have a striking epiphany (usually completely inconsequential to anyone but me).

I just finished reading an editorial by Ann Coulter (that vituperative vagina--or as I prefer: "the venomous cunt") about Senator Craig's Bathroomgate.

Coulter is a gay camp figure on par with Bette Davis or Divine.

There you have it, my words of wisdom, brought down like biblical fire from a mountaintop.

After having a 30 minute (predictably) frustrating phone conversation with Mediacom (the unholy bastards!) I took out some frustration on my new dumpster dive find: a fabulous solid wood dresser in need of total refinishing. Which, by the way someone had not single, but double veneered.

Men have been hung for less.

Dividing my time between:
1) Work--I'm almost done genotyping (30,000+ data points, lol)! It's almost time to run mapmaker...
2) Gardening--I'll post pictures when it starts to look good. Let me just say that just looking at my opal basil makes me happy. Sigh.
3) Finding time to practice. Taking a break from the pretentious seriousness of Chausson's symbolist serres chaudes (how fitting, I know), the disturbing Wolf ala the Spanisches Liederbuch, and focusing on the Charles Ives. Old Charlie and Poulenc are probably my two favorite composers. I just get what they wrote--I often imagine myself taking walks by the Houstatonic with Ives or lunching with Francis at Maxim's.
4) Having a social life. I feel surrounded by friends more now than ever. What is it with summer?
5) Finding time for some strenuous exercise. Lane and I have been going mountain biking occasionally, and I am forcing myself to go the gym tomorrow. To continue with my Norman Rockwell fixation, here's a representation of my body image (Lord knows how many times I perused our coffee table book and wound up crying over this one).

Learn something new every day

So I just spent the last two hours trying to figure out how to add a column of text to a column of numerical values (so I can print out some plate arrays).

Turns out that Excel has an operation called "concatenate", which comes from a Latin word meaning "to link together in a series or chain". Who know, right?

Yes, I'm proud. I feel as if I've defeated Microsoft.

1) Is there another Shakespeare waiting to be discovered? Some Emily Dickinson-style bard with a hence-to unrecognized bureau drawer full of genius?

2) I now find Eluard decadently introspective, brooding, and pretentious. The emperor has no clothes.

3) I'm having a hard time striking a balance between taking myself too seriously and sinking into flippant silliness. The age old Mahler vs. Poulenc?

Free booze is a dangerous thing.

The jury is finished

And now I can concentrate on:
1) Making a Greek salad with the works: artichoke hearts, feta, red onions, kalamati olives, and salad greens so I can enjoy lunch tomorrow while I:
2) Study all day (seriously all day) for the evolution final, after I have:
3) Done some annual planting in the north garden after I have:
4) Gone for a bike ride in the morning, and in the evening:
5) Fall asleep by myself curled up with a rather large bottle of amaretto (whom I am cheating on with midori) while:
6) Listening to "Mira o Norma", the fabulous Serafin recording with Callas from 1952ish

In other news I am feeling overwhelming Protestant guilt about leaving the science to enjoy the world (NYC and FL). Suggestions?

Who would have known that this week would be so busy? Jesus! Probably my jury is the most stressful part of the schedule because it also reflects on my teacher.

Been reading, writing, and such all day since Sunday night. No end in sight.

I did find time to make it out to the 'last' "Monday night"--a group of friends that take their Monday night debauchery seriously. Nostalgic? Perhaps.

Everyone was dressed up in some sembalence of a costume, Nick was 'white trash' (surprise?), Rebecca was 'from the future', Natalie was classy Natalie. After trying on a tux and then a lesbian outfit, I decided to go as someone who got lost on the way to the beach (I'm in desperate need of some sun) and happened to be holding a mug full of peach schnapps and ice. Wow, I know.

Oh shit here we go!

(last week before I leave for NYC and then FL to visit Alan/rents-sises respectively)

And nature sympathized.

The last week was busy. The next week will be even more busy.

Here's a list of what's a-goin' on:
1) 2 projects due for molecular lab (a grant proposal and 15 min oral presentation--I'll do the talking not my GOTBY Asian lab partner)
2) Memorize some Wolf for my jury--it's going to be a total joke, but who cares.
3) Vocal lit final
4) Evolution test #3 and final
5) 2 evolution homeworks (one is: "find a fossil")
6) Poster presentation on Monday (stand in front of 9-month old data)
7)10 hours of tutoring.

Now that I've made a list, it doesn't seem so bad.

Some highlights of this last week:
1)Going to a "politically subversive burlesque" show that benefited the Center. It basically consisted of chubby lesbians dancing around with electrical tape on their nipples. Pretty routine Wednesday night.
2)Going to the Vu for comedy night and running into the smart sorority girl I tutor and her mother who was SCHWASTED. Mother's weekend. Classic.
3) Going to the batting cages with my BF and catching bugs. Yep.
4) At long last watching Shortbus.
5) Getting this picture (yes, I am wearing a SS shirt) from when Dennis and Mike and I hung out over spring break. Mike is one of my most favoritest people I've met at Mizzou and I'll miss him--although he is going to UCSF and if I go to UC-Berkeley or Stanford I might see him often.

Other than that...
I'm going through a Paul Eluard kick?

The commedia is over!

While walking to work today I was accosted by a wastafarian (or a trustafarian as Alan says) handing out “subversive” literature. He said with a wink, “We need a drastic change.”

The pamphlet basically consisted of an advertisement for some sketchy cult “12 acres” (or something to that effect)—promoting some commune lifestyle and showing pictures of people who were wearing happy drug-smiles.

Needless to say I didn’t quite get the gist of it, but it was one of those vague “let’s all live in harmony” things.

I want to set the record straight: I have nothing against cults. If I did, I would have a problem with the majority of the Bible belt. What I take issue with are communes. Maybe it is my (not so carefully) camouflaged misanthrope attitude, but I don’t trust anyone who can live in close proximity with other stinky hippies. Thoreau-ing is okay with me, but communes…ugh.

As I was thinking over said event, I realized what actually shocked me most is that there are still people in the world that are idealistic. Believe they can make a “drastic change”—whatever that may be.

Maybe I have been inculcated by too many petulant, government-hating conservatives, but people who think they can save this country from its democratic-socialist destiny make me uneasy.

Besides, it’s not my style to stand abreast history waving my arms and yelling, “Stop”.

After we are left a crumbling nanny-state I would rather raise my glass of absinthe as the curtain closes and cynically proclaim "La Commedia e finite."

My boyfriend brought me chai. Yay!

Here are things that I’ve noticed lately that would probably strike anyone (who is not a total spaz like me) as unremarkable:

1) A guy being pulled over in a parking lot on campus, discussing with the faux-po *in detail* the Mizzou basketball team, scores, etc. I’m feeling like I would have a distinct disadvantage in “straight” talking my way out of traffic violations.

2) Two Asian students (apparently from different countries, i.e., “Are you Chinese or Japanese?” “No, I’m from Laos, it’s a land-locked country in south of Asia…”) who were trying to communicate a sandwich order at the union.

Asian♀-sandwich-maker: Would you rike pickers?

Asian♂-sandwich-orderer: Pickers?

Asian♀- sandwich-maker: Yes, loast beef sandwich?

All in all, a cute exchange. They were trying so hard, I suppose some soft Copland music should be played in the background.

3)I almost slept through evolution the morning after Craiger’s B-day party (Ed=2 Bermuda triangles), so I grabbed some stuff to take notes on at his house. After taking notes about vertebrate eye homology I got curious and began flipping through the notebook to see what else was in there. I took Craig’s crazy-cult/brainwashing Mormon religion class notes from BYU.

Previous page, and I quote: “Ch10 v17, spiritual gifts come by Light of Christ”. I suppose Christ’s Light should be capitalized, in the vein of THE Holy Spirit’s Left Sandal…

Ch9 “don’t give up”

v.16: “Sprit of Christ~ conscience (D+C 88)”

“characteristics”

1) “truth shineth”

2) “light in all things”

3) “life to all things”

4) “power of God”

Oh, Jesus. The irony was not lost on me…it was a nice diversion from a class I hate so much.

It was about a million degrees in Jake Shear's pants tonight.

Fleeting moment of self-awareness today:

We accept living in relative poverty and chic-bleak surroundings because we have something that no Escalade-driving middle aged real-estate agent has: youth. It is a constant source of strength, smugness, and justification for our bohemian existence. It is our priceless and fragile commodity.

The eternal darkness and cold is wearing on me. Today I started planning my garden—it is one of the few things that can make me forget that I live in a place I hate for 1/3 of the year.

I plan on having a splendiferous garden, full of heirloom vegetables and herbs and flowers and magic! Well, maybe not magic. But I certainly plan on buying the plastic molds in the shape of president’s heads so I can grow some Nixon and Carter tomatoes. Que indígena?

I have spent the last couple of days at work (ugh) and translating and IPA-ing some Swedish texts for my Sibelius set. PS, the Swedish chef on the muppets was not an exaggeration.

Also I am highly anticipating the arrival of my Jacques LeGuerney CD, and a tape of songs called “Reality Sandwiches” (text by Ginsberg).

Tomorrow portends my doom: 2.5 hours of class, a voice lesson, 5 hours of work, 2 hours of tutoring. Although judging by the (seemingly representative) mouth-breathing, intellectual tundra girl who is incapable of fathoming analogies that sits in front of us in class; i.e, “how can you make that comparison, a mousetrap isn’t even alive”—my evolution test tomorrow morning should be a breeze.

There's a boy I know

Craiger brought me some Häagen-Das black raspberry chip after a shitty Monday.

I love him.

(I know you are going to comment: "Um, I vomited in my mouth a little." Robyn)

And yes, the title is an allusion to a Whitney song.

Insomnia inspired Harvard dictionary of music perusing motivated me to formulate a sketch for an underwater opera.

I suppose Scriabin has the choke-hold on outer space performances, and Stockhausen has a monopoly on helicopter string ensembles.

But underwater opera—that’s where it’s at baby.

Can you imagine Aida with fanned-out hair that hangs listless in the water, or Billy Budd with sea-soaked clingy overalls?

Ok I’m done. I’m just sayin’…

Dick in a box

1) Cut a hole in a box

2) Put your junk in that box

3) Make her open that box

And that's the way you do it!

(I had fun time at trops/shattered/"el rauncho" tonight!)

"Cher, our stock would plummet"

Had a wonderful and relaxing Christmas at home: I mostly played monopoly with my little sisters, and watched fox news (lol) with my parents. Got BioGen stock from my parents, a scissor sisters poster from Craiger, and a Schlitz beer Saturn-shaped light fixture thing from Al.

It will be displayed prominently and lovingly as a document to the silly shit my brother is always doing.

My break consists of getting my QTL mapping on 10+ hours a day, working out, writing some goddamn stupid personal statements for a huge scholarship—one of those “you know I deserve the money so just give it to me” things.

Have been listening to a lot of Cecelia lately. Definitely a fan, if just for sheer originality, even though her voice is not without some pedantic controversy.

Taking Zipper to the dog park in the morning to play with Robyn and Molly. Hopefully Zipper will keep it in his pants—metaphorically that is, as he doesn’t wear actual pants because he is a fucking dog.

Love.

Getting drunk at work on a Friday afternoon, riding my bike home in the snow, and listening to Freder-Deder and Schwarzkopf sing Wolf's Spanische Liederbuch is my favoritest thing *ever*.

SNOW DAY!

Woke up to find my 8+ months pregnant roomie, Mey-ru shoveling her car. Since I didn't feel like driving a woman in labor to the hospital, I finished the driveway. Heavy snow=back-ache.

Pouty pirate?

Encouraged by a dance remix of Holiday, I spent the *entire* day compiling our project for molecular: the Ultrabithorax gene in drosophila, and if I do say so myself, that it is a manifesto.

What am I going to do tommorrow?

Woke up in a cold sweat this morning before my alarm.

Had a dream where the "very hungry" snake that I had "forgotten" in my backpack for several weeks got out and was chasing the dean of the school of music and biting him. I was running in circles on Lowry mall while the snake stretched like an rubber band to chase me from the horizon.

Surreal?

Oh, and it had the colorings of a coral snake, but the body morphology of a green mamba. All skinny and menacing like.

What is it with the Grow boys and snake dreams?

----

Watched Transamerica with Manda at her request for her term project about transsexual parents.

Me at work, on my phone: "Well, do you know any transsexual parents?"

Kevin Zegers...mmm

No one came to my tutoring session tonight, so I had some down-time. Which I spent very unproductively looking at the fluorescent lights and trying to feel my DNA undergoing transcription.

Hey, there it goes!

Woops, false alarm.

Sang a Mozart duet with Becca at the Chancellor’s Residence Preservation Society’s “Italian Garden Party”—aka, how to raise $100,000 to fix up your own house. I was prepared for gratuitous hobnobbing and mingling after being warned of what a “little get-together” for these people usually entails by Craiger—who regularly did things like this with FAWCM.


Many expensive and exotic birds about, including one woman (while dressed to the nines, make-up applied with a paint roller and all, double fisting a wine glass + a program) told us: I would applaud, but I don’t a free hand. [Insert Phyllis Diller laugh, head tilted back 90۫)

Fabulous.

Later we ran into her and she said in passing (still holding the Chardonnay aloft as a liberty torch of sorts): “Went to the Peking opera last weekend. It was horrible. Never go.”

Absolutely fabulous.

All in all, fun (if insincere) atmosphere for performing—and amazing food.

********

Wore my glasses to work tonight, and when leaving Tucker, I scraped a university van parked all of about 4 inches to my right. Got out and explained to the guy that I “can’t see a fucking thing with these goddamn glasses on”. He seemed very nonchalant and reassured me he could care less about a scratch.

While not hitting parked cars today I, in short:
1) Went to work
2) tutored
3) practiced
4) had Die Zauberflöte rehearsal
5) Went to class
6) made a marinated artichoke heart, calamari olive, tomato, feta, red onion, evo, and lemon basil (picked from my front porch, thank you very much) salad to go with my roast beef and tahini-dijon sandwich tomorrow.

Played beer pong with Champagne while listening to Tchaikovsky (= V for Vendetta).

I’ve planted the seeds of incongruity in my life—now all I have to do is harvest them.

Had a fabulous weekend:
Played with zipper, Craig’s new miniature Schnauzer puppy Saturday morning then went to see half-naked men wearing short shorts with Robyn. I mean, went to watch the Rugby game with Robyn. Right...

Went to Shatterday—it was fun, but I required more libations than usual to coerce the dancing. Acted a damn fool, but that’s what Shattered is for I guess. (PS, starting to feel disdain for Saturdays=such a plebian evening, with all the working blokes out and such)

Spent most of Sunday reading the A/L from the Times. And practicing. And doing homework. And at work.

So far everything is going well with me this semester. However, I am freaking about my recital in a month (mostly because the last Poulenc I’m working on are total bitches technically). But classes are going well, opera is going well, work is going well, etc.

Haven’t had the usual major autumnal flip-out that I am accustomed to, so that might be in the making. Prends garde-toi.

Thanks to Mands, I have the new scissor sister's album. And I listened to it *all* day. I have a love in my heart for Jake Shears, because I feel like I really "get" him and what he does. Sighs.

I also watched La Dolce Vita and now am planning to embark on a Netflix induced Fellini fest. If anyone wants to laboriously discuss the movie with me over coffee in a dark jazz house while we wear our side-cocked berets...I'm in.

 
Picture of my ken-doll boyfriend, Craig.

 
Later at Trops where Craig wore the great-googly-moogly Robynesque glasses.

 
Craig, me, and our new friend Emily making "contemplative" faces.

Show me your bones

Wow, it’s been a while. I’ve been busy. Doing what, you ask?

Ripping up the carpet in my new house, scraping the latex paint off my woodfloors, then sanding them (by hand), staining and polyurethane-ing them. Moving in. Working 40 hours a week while starting my senior year, tutoring at the Learning center, training new rotation students, picking out a recital date (OMG!), and trying to start reviewing for the GRE.

Oh, and getting Mediacom to turn on our internet. How I lament them and their monopolistic/exploitive ways.

The good news is I abso-fucking-lutely love my new house, Rachel, and Me-Ru (my two roommates). Hopefully I’ll post some pictures of my bedroom—decorated in a “natural fiber” motif.

I used the approach developed by Manda and I to buy fireworks to select paint for my room. The walls are “pond-lilly green”—as I told Mandy, “gay-in-a-bottle”. I know Alexis would be proud.

I have to go practice some opera before meeting Craiger and assorted straights at the Coliseum for some well-deserved Bombay Saph. G&Ts.

Ah the pathos!

Sparked by Garet’s post lamenting more of the same—I have finally congealed my opinion of the package shipping industry.

When our lab ordered Red-Taq, a DNA polymerase that costs $1000/30mL, DHL let shipments sit on their 95 degree truck overnight. Needless to say, the taq was worthless. Our lab didn’t have to pay for this of course—by DHL had to eat the cost. This happed 3 times.

When I order something from Amazon.com, if I don’t explicitly specify on the shipping instructions to put the package in my mail-box, the UPS guy will make attempts to deliver it to my locked door every day at 7AM for 4 days—when it’s company policy to send the item back. This happened 4 times. Seriously…mail goes in mailboxes.

So, what’s a girl to do?

Well, I could get mad and call some 800 number and talk to some phone-zombie in Nebraska, or I could examine the larger social implications of this phenom.

Really, the same thing has happened with the medical industry. When my grandmas were entering the job market, it wasn’t acceptable for intelligent women to be doctors. So they became teachers and nurses. Nowadays there isn’t a barrier to keep competent women from becoming doctors, so that leaves a void in positions that used to be stricty “for the girls”--teachers, nurses, etc.

All the capable men—men who when given a job use common sense to efficiently accomplish it—don’t work for DHL, Fedex, UPS. They are now CEOs. America has been invaded by the “duhs”.


As we all know, I can’t go 5 minutes without being some pansy queer, so I will negate any intellectual worth of what I just wrote.

Here’s this. YUM.

 

The song is "Send me an angel" by Real Life. But Sarah and I could both swear that they said, "send me an Asian."

Boy, does that conjure a bizarre mental image.

2 realizations

1)I can and will go on living my life as one big "cost-benefit-ratio".

2)Mahler is so emo. Sometimes we all need a good cry.

Ok I have a confession. A deep dark confession.

I feel like after the first few months of blogging I have revealed all the interesting thoughts, desires, experiences (I would feel comfortable sharing with an anonymous reader).

I've told you, gentle reader, of my:
parallel life with Norman Rockwell paintings,
my disdain for Telemundo,
emulation of Florence King--a southern humorist and misanthrope,
First experience with the sea,
fondness of quoting obscure Whitman,
my dreams in which I lead a field of cheerleaders to South Pacific's "gonna wash that man right otta my hair"

But now all I have to talk about is how I spend 65+ a week at work, run to the gym or FAB, and then climb into bed so I can wake up and do the same thing the next day. Starting at 6:00AM.

If there’s anything more pathetic than a uninteresting person—it’s a uninteresting person trying hard to be witty or interesting. “I’m quirky. Like me!” (pleading) “Really—I’m quirky and interesting.”

I mean, I wear little nerd glasses, I watch several Rag-tag films a month, I read Trends in Genetics and practice bel canto arias in my free time. Why do I feel so bland?

Think Mildred from Of Human Bondage.

So, here it is: the one shred of a tidbit of something about me no one else knows:

Each week when I read postsecret, I try to pick out which ones might apply to me. I think of it as a horoscope of sorts. This week’s checklist:

Acceptance
Desperation
Cynicism

But the one that fits me best is:

 

I can bitch, bitch, better than you!

110 degrees with the heat index. Day number 3 of getting up at 5:30 so I can be at the field with my cooler by 6:15AM.

Delusional from the sun, I am imagining be-sequined black afro'd back-up dancers singing "Ooo, talkin' bout a heatwave!". Think Sister Act. I know.

The good news is: I think my tongue is dyed permanently blue from the 4 liters (I'm absolutely serious) of delicious, delicious poweraid that I drank today.

PS- I fucking hate glorified secretaries with PhDs. And a democratic socialist state that sanctions their existence. That is all.

Tina Turner & Elton John - The Bitch Is Back Live '99

Timely.

Carreau! Pique!

Rainy days are perfect for ruminations. Stewing. Milling. Contemplation.

Here’s what I thought about today:

To hearken back to last night Mark and Craig: I do believe Pears and Britten were both versatile, but definitely Francis was the top, and Bernac the bottom. I just can’t imagine Poulenc on his back getting jack-hammered by a lyric baritone. Why do I care?

Strong women intimidate me. And turn me on. How naughty.

Epigenetic regulation of polyploids is more interesting than my current QTL mapping project of Spb1. However, our Chromosome 7 QTL is very close to zmet1 (a methyltransferase), histone 1a, but also intensifier 1. I hope to the Divine Miss M that Spb1 is actually an epigenetic modifier of Pl-Bh. If it’s not I will throw a tantrum.

Bombay Sapphire is the best gin ever made. I would so pour it on my Cheerios in the morning. Don’t tempt me.

Brent Corrigan can wurk it.

le choix (n'est pas heureux)

Carmen is over! It was absolutely breathtaking. Pictures to follow. Thanks to everyone who came--singers are fragile.

Robyn’s 21st B-day party was preposterous. Imbibed way too much, and spent most of this afternoon rehydrating and watching the Cup finals. Zidane?! Wtf.

It lingers, then you forget (you're a rock-n-roll suicide)

Oh Children.

After my blog was down for a couple days last week (wtf?) and Alan asked me if its leave of absence portended my death, I just wanted to see if posting worked. So “erer” were the first 4 letters that my little fingers hit. Sorry to all your theories. And Garet, you know I don’t do anything by accident.

My B-day was fabulous! I drank a lot and remembered most of it. I feel so blessed to have such fabulous friends. Sigh. Dancing to pussy control with Emily Bennett was an experience.

In other news:

Working like a maniac!

Nervous for Carmen, practiced for 4 hours today.

To my utmost delight, my fridge didn’t liquefy my bag of mixed greens from Miriam. So right now I am making a tomato, feta, lemon-garlic chicken, cranberry/walnut salad with Raspberry vinaigrette dressing. Eat your heart out.

Random story from this morning:

Having breakfast at Cucina Sorella this morning, and when some very dykey girl loudly ordered the exact same thing as me, it prompted my aghast question: “Is that lesbian food?”

Craig: “Does it come in a large bag like birdseed or dogfood?”
Ed: “Purina Lesbian Chow, now with real bits of carpet.”

Someone should really stop us. So un-PC.

erer

Just got back from a float-trip (aka, 48 hours of non-stop debauchery).

Quote of the trip: As we were talking to the camp owner about our liability waiver we had to sign Joe says, "Whoa. Excessive drinking? We're getting into kind of a gray area here."

So whenever I get pictures for that I'll post them.

In other news: My B-day is on Thursday! I turn 21! Watch out Como! I'm going to burn you to the ground!

At the risk of being once again chided by Craig, I'll post my birthday present wishlist, which consists of one thing.

Oh, and Alan, if midget porn is decadent, what is Hungarian-homosexual-Identical-twin-porn?

 
Baseball in the dark is a bad idea! K-Dawg, Lane, and Craig are apparently making badass faces...I didn't get the memo. Maybe I was too busy being hit with a baseball in the eye.