Yay for drinking mimosas at work on a Friday afternoon and then grinding worms while listening to RuPaul's "Cover Girl (Put the Bass in Your Walk)" when totally buzzed.
Later tonight we're having a Seder celebration (Go Jew Party!).
I love Stanford.
Friday, April 10, 2009
Wednesday, April 08, 2009
The atmosphere is very Macbeth-ish. What has, or is about to happen?
Just read an article about the United States Secretary of Education Arne Duncan.
The former CEO of Chicago's public schools, apparently tried his best to rescue the crumbling system with of all things (gasp!) accountability. Although short on specifics, the article details his approach of natural selection to weed out underperforming (PC speak for "shitty") schools. Not a popular choice with teacher's unions--who despite professing valuation of students' education, continue to openly sabotage even the smallest whiff of reform--the strategy is vaguely reminiscent of ermm...the free market.
I should quit my day job and become an oracle: Duncan--heavy on rhetoric and light on action--a mid-forties, attractive, glorified Chicago bureaucrat, Harvard grad (sound familiar yet?) will fail to deliver on 90% of his promises.
I'll be honest, I have a grudge against public (K-12) education. I had numerous excellent teachers in the small town I grew up in; I will always remember those that changed my life for the better: Jeff Sandquist (my choir teacher), Mary Wilkerson (my AP Calc teacher), Mrs. Hammond (my chemistry teacher), Mrs. Ewing (my American Lit teacher). I was more fortunate than inner city Chicago kids.
But most of my time from the age of 5 to 18 was wasted by ineffective, incompetent, uninspired, and uninspiring lifers. These are the parasites that make up the bulk of teachers' unions.
As of late I have recessed from a rabid fascination with politics and public policy. It makes my blood boil to think about how the faux distinct Republidemocrats are flushing my beloved country down the toilet with their imperialism and grandiose redistribution of wealth.
My instinct is to play the violin as Rome burns, but something is amiss.
I finally put my finger on it. From far away, the farce called America provides better entertainment than RuPaul's Drag Race. Close up, it's too grotesque to watch.
[Edit: Thank god for Iowa?! I never thought I would say that.]
The former CEO of Chicago's public schools, apparently tried his best to rescue the crumbling system with of all things (gasp!) accountability. Although short on specifics, the article details his approach of natural selection to weed out underperforming (PC speak for "shitty") schools. Not a popular choice with teacher's unions--who despite professing valuation of students' education, continue to openly sabotage even the smallest whiff of reform--the strategy is vaguely reminiscent of ermm...the free market.
I should quit my day job and become an oracle: Duncan--heavy on rhetoric and light on action--a mid-forties, attractive, glorified Chicago bureaucrat, Harvard grad (sound familiar yet?) will fail to deliver on 90% of his promises.
I'll be honest, I have a grudge against public (K-12) education. I had numerous excellent teachers in the small town I grew up in; I will always remember those that changed my life for the better: Jeff Sandquist (my choir teacher), Mary Wilkerson (my AP Calc teacher), Mrs. Hammond (my chemistry teacher), Mrs. Ewing (my American Lit teacher). I was more fortunate than inner city Chicago kids.
But most of my time from the age of 5 to 18 was wasted by ineffective, incompetent, uninspired, and uninspiring lifers. These are the parasites that make up the bulk of teachers' unions.
As of late I have recessed from a rabid fascination with politics and public policy. It makes my blood boil to think about how the faux distinct Republidemocrats are flushing my beloved country down the toilet with their imperialism and grandiose redistribution of wealth.
My instinct is to play the violin as Rome burns, but something is amiss.
I finally put my finger on it. From far away, the farce called America provides better entertainment than RuPaul's Drag Race. Close up, it's too grotesque to watch.
[Edit: Thank god for Iowa?! I never thought I would say that.]
Thursday, April 02, 2009
Utterly disturbing realization #586,359

Young Stalin was hot! Look at Miss Joseph work that scarf and Guido hair!
At this point he was a 5'4", pockmarked, former seminary student and soon-to-be p
Slap a pair of X-ist briefs on this 24-year old Uncle Joe and he could go work for Michael Lucas.
Tuesday, March 31, 2009
Cher: Would you call me shallow? Dion: No. Not to your face.
Shopping for clothes: Cher from Clueless:: Shopping for antibodies: Me.
How much of a nerd am I?
Abcam, Novus, Upstate (now owned by Millipore, who knew?) have made me want to go into biotech instead of academia.
Dolla, Dolla billz, y'all.
How much of a nerd am I?
Abcam, Novus, Upstate (now owned by Millipore, who knew?) have made me want to go into biotech instead of academia.
Dolla, Dolla billz, y'all.
Monday, March 23, 2009
I have meaning to write about this for a long time...but never could really bring myself to actually do a post about Michael Lucas.
He's the bratty child in the grocery store who throws a foot-stomping tantrum. And instead of his yuppie mother leaning over and politely asking him to share his feelings, she should unwaveringly bludgeon him with the nearest piece of produce, ideally a unripe pineapple.
Giving him any attention and then lamenting his overexposure (pun definitely intended) is a delicate tightrope act, so I'll do my best.
For those of you who don't know, Michael Lucas is a gay porn kingpin originally from mother Russia, but currently based in NYC. I have read his blog (warning NSFW, read: this means you Bees!) with eagerness for about four years. Never one to miss even the most banal opportunity for publicity, Michael without fail posts links to the various D-list magazines willing to stoop low enough to interview him..and usually take pictures of his disgusting dick/him wearing high-end fashion designed to distract us from his Zoolander lips.
From Michael I learned about anal douching, the dangers of barebacking, the safety of oral cumshots, and a slew of other non-porn related topics.
Believe it or not, the most interesting part of reading his blog is learning about his political views. He is so refreshingly un-PC-- in a world full of queens watching what they say at every turn, it is nice to have some frankly offensive "straight" talk. Most of Michael's political views are driven by his unashamed support of all things Israel and his uncompromising gay agenda.
As I remember, he was very tough on Hillary Clinton, the seemingly unchallenged darling of the LBGT community during the 2008 presidentialfarce race. Hillary is the ultimate two-faced Janus of a politician, and Michael calling her out on cockteasing the queer electorate won him points in my book.
I cannot tell you how hard I laughed when I read his interpretation of California's passing of prop 8 in an entry entitled The Mormon-Black Axis of Hate. Provocateur or serious? You be the judge.
Always one to use his perspective as an immigrant from the crumbling Soviet Union, Michael often comments on US fiscal policy:
All of this government “help” is making me concerned that this country is moving towards socialism, which I so happily escaped. The government is not your loving mother who will come and rescue you from any situation you've put yourself in.
Jumping at any chance to slam Islam, Iran, or Saudia Arabia, Michael never lets anyone forget that he's a Jew. And that homosexuals are discriminated against and often executed throughout the middle east, Israel being the shining exception.
But what is the real reason that anyone puts up with all his self-aggrandizing vitriol? He's holding daddly-licious Wilfried Knight hostage.


Nevertheless, I find Michael's blog captivating, reading it with bated breath everyday like a jury looking at autopsy photos through spread finders.
When he's ready to brunch with me and discuss coming out of the closet as a fiscal conservative, I'll be waiting.
He's the bratty child in the grocery store who throws a foot-stomping tantrum. And instead of his yuppie mother leaning over and politely asking him to share his feelings, she should unwaveringly bludgeon him with the nearest piece of produce, ideally a unripe pineapple.
Giving him any attention and then lamenting his overexposure (pun definitely intended) is a delicate tightrope act, so I'll do my best.
For those of you who don't know, Michael Lucas is a gay porn kingpin originally from mother Russia, but currently based in NYC. I have read his blog (warning NSFW, read: this means you Bees!) with eagerness for about four years. Never one to miss even the most banal opportunity for publicity, Michael without fail posts links to the various D-list magazines willing to stoop low enough to interview him..and usually take pictures of his disgusting dick/him wearing high-end fashion designed to distract us from his Zoolander lips.
From Michael I learned about anal douching, the dangers of barebacking, the safety of oral cumshots, and a slew of other non-porn related topics.
Believe it or not, the most interesting part of reading his blog is learning about his political views. He is so refreshingly un-PC-- in a world full of queens watching what they say at every turn, it is nice to have some frankly offensive "straight" talk. Most of Michael's political views are driven by his unashamed support of all things Israel and his uncompromising gay agenda.
As I remember, he was very tough on Hillary Clinton, the seemingly unchallenged darling of the LBGT community during the 2008 presidential
I cannot tell you how hard I laughed when I read his interpretation of California's passing of prop 8 in an entry entitled The Mormon-Black Axis of Hate. Provocateur or serious? You be the judge.
Always one to use his perspective as an immigrant from the crumbling Soviet Union, Michael often comments on US fiscal policy:
All of this government “help” is making me concerned that this country is moving towards socialism, which I so happily escaped. The government is not your loving mother who will come and rescue you from any situation you've put yourself in.
Jumping at any chance to slam Islam, Iran, or Saudia Arabia, Michael never lets anyone forget that he's a Jew. And that homosexuals are discriminated against and often executed throughout the middle east, Israel being the shining exception.
But what is the real reason that anyone puts up with all his self-aggrandizing vitriol? He's holding daddly-licious Wilfried Knight hostage.


Nevertheless, I find Michael's blog captivating, reading it with bated breath everyday like a jury looking at autopsy photos through spread finders.
When he's ready to brunch with me and discuss coming out of the closet as a fiscal conservative, I'll be waiting.
Monday, March 16, 2009
Glück das mir verblieb
What a fantastic whirlwind the past few days have been.
Last week was the last "real" week of the quarter. The perl continued to eat my soul to the very end. The last few days before my project was due were spent lying in bed (like some Victorian invalid) , surrounded by tea service, curtains drawn, continuously coding.
But it is done, and as soon as I finished, the jagged and strident circus music--as if piped through a tin can directly into my atrophied brain--stopped.
On Sunday, to my delight, I went barrel tasting with Lia, Jay, Biff, Jan, et al to Sonoma. Needless to say the escape from the utter monotony of pedestrian faux-chic Palo Alto was appreciated. A wonderful day spent in the NorCal countryside sipping ports, merlots, cab savs, and pinots. Totally burned out on red wine for the time being.
Despite a rather bizarre day on campus, two facts remain: the in vitro chromatin assembly worked, and I'm fuckitty-fucking done with genomics!
Craig is visiting/job-hunting next week, so I will get to see my baby and enjoy spring break.
Last week was the last "real" week of the quarter. The perl continued to eat my soul to the very end. The last few days before my project was due were spent lying in bed (like some Victorian invalid) , surrounded by tea service, curtains drawn, continuously coding.
But it is done, and as soon as I finished, the jagged and strident circus music--as if piped through a tin can directly into my atrophied brain--stopped.
On Sunday, to my delight, I went barrel tasting with Lia, Jay, Biff, Jan, et al to Sonoma. Needless to say the escape from the utter monotony of pedestrian faux-chic Palo Alto was appreciated. A wonderful day spent in the NorCal countryside sipping ports, merlots, cab savs, and pinots. Totally burned out on red wine for the time being.
Despite a rather bizarre day on campus, two facts remain: the in vitro chromatin assembly worked, and I'm fuckitty-fucking done with genomics!
Craig is visiting/job-hunting next week, so I will get to see my baby and enjoy spring break.
Wednesday, March 11, 2009
Dolly Parton and Jennifer Holliday make life worth living.
I had a really good day today. That is all.
I had a really good day today. That is all.
Monday, February 09, 2009
head full of straw
Fuck you perl! Why is this so hard?
I want to join an array composed of sequence that I split based on position within the array. I spent the last two hours figuring out how to do this, and this is all I came up with. It works, but Jesus:
#!/usr/bin/perl
use strict;
use warnings;
my $seq = qw(GGGCCGGCTCGCGGGCGCTGCCAGTCTCGGGCGGCGGTGTCCGGCGCG
CGGGCGGCCTGCTGGGCGGGCTGAAGGGTTAGCGGAGCACGGGCAAGGCG
GAGAGTGACGGAGTCGGCGAGCCCCCGCGGCGACAGGTTCTCTACTTAAAA
GACAATGACTACTGATGAAGGTGCCAAGAACAATGAAGAAAGCCCCACAGC
CACTGTTGCTGAGCAGGGAGAGGATATTACCTCCAAAAAAGACAGGGGAGT
ATTAAAGATTGTCAAAAGAGTGGGGAATGGTGAGGAAACGCCGATGATTGG
AGACAAAGTTTATGTCCATTACAAAGGAAAATTGTCAAATGGAAAGAAGTTT
GATTCCAGTCATGATAGAAATGAACCATTTGTCTTTAGTCTTGGCAAAGGCC
AAGTCATCAAGGCATGGGACATTGGGGTGGCTACCATGAAGAAAGGAGAGA
TATGCCATTTACTGTGCAAACCAGAATATGCATATGGCTCGGCTGGCAGTCT
CCCTAAAATTCCCTCGAATGCAACTCTCTTTTTTGAGATTGAGCTCCTTGATT
TCAAAGGAGAGGATTTATTTGAAGATGGAGGCATTATCCGGAGAACCAAACG
GAAAGGAGAGGGATATTCAAATCCAAACGAAGGAGCAACAGTAGAAATCCA
CCTGGAAGGCCGCTGTGGTGGAAGGATGTTTGACTGCAGAGATGTGGCATT
CACTGTGGGCGAAGGAGAAGACCACGACATTCCAATTGGAATTGACAAAGC
TCTGGAGAAAATGCAGCGGGAAGAACAATGTATTTTATATCTTGGACCAAGA
TATGGTTTTGGAGAGGCAGGGAAGCCTAAATTTGGCATTGAACCTAATGCTG
AGCTTATATATGAAGTTACACTTAAGAGCTTCGAAAAGGCCAAAGAATCCTG
GGAGATGGATACCAAAGAAAAATTGGAGCAGGCTGCCATTGTCAAAGAGAA
GGGAACCGTATACTTCAAGGGAGGCAAATACATGCAGGCGGTGATTCAGTAT
GGGAAGATAGTGTCCTGGTTAGAGATGGAATATGGTTTATCAGAAAAGGAAT
CGAAAGCTTCTGAATCATTTCTCCTTGCTGCCTTTCTGAACCTGGCCATGTGC
TACCTGAAGCTTAGAGAATACACCAAAGCTGTTGAATGCTGTGACAAGGCCC
TTGGACTGGACAGTGCCAATGAGAAAGGCTTGTATAGGAGGGGTGAAGCCC
AGCTGCTCATGAACGAGTTTGAGTCAGCCAAGGGTGACTTTGAGAAAGTGCT
GGAAGTAAACCCCCAGAATAAGGCTGCAAGACTGCAGATCTCCATGTGCCAG
AAAAAGGCCAAGGAGCACAACGAGCGGGACCGCAGGATATACGCCAACATG
TTCAAGAAGTTTGCAGAGCAGGATGCCAAGGAAGAGGCCAATAAAGCAATGG
GCAAGAAGACTTCAGAAGGGGTCACTAATGAAAAAGGAACAGACAGTCAAGC
AATGGAAGAAGAGAAACCTGAGGGCCACGTATGACGCCACGCCAAGGAGGG
AAGAGTCCCAGTGAACTCGGCCCCTCCTCAATGGGCTTTCCCCCAACTCAGG
ACAGAACAGTGTTTAATGTAAAGTTTGTTATAGTCTATGTGATTCTGGAAGCA
AATGGCAAAACCAGTAGCTTCCCAAAAACAGCCCCCCTGCTGCTGCCCGGAG
GGTTCACTGAGGGGTGGCACGGGACCACTCCAGGTGGAACAAACAGAAATGA
CTGTGGTGTGGAGGGAGTGAGCCAGCAGCTTAAGTCCAGCTCATTTCAGTTT
CTATCAACCTTCAAGTATCCAATTCAGGGTCCCTGGAGATCATCCTAACAATG
TGGGGCTGTTAGGTTTTACCTTTGAACTTTCATAGCACTGCAGAAACCTTTTA
AAAAAAAATGCTTCATGAATTTCTCCTTTCCTACAGTTGGGTAGGGTAGGGGA
AGGAGGATAAGCTTTTGTTTTTTAAATGACTGAAGTGCTATAAATGTAGTCTG
TTGCATTTTTAACCAACAGAACCCACAGTAGAGGGGTCTCATGTCTCCCCAGT
TCCACAGCAGTGTCACAGACGTGAAAGCCAGAACCTCAGAGGCCACTTGCTT
GCTGACTTAGCCTCCTCCCAAAGTCCCCCTCCTCAGCCAGCCTCCTTGTGAGA
GTGGCTTTCTACCACACACAGCCTGTCCCTGGGGGAGTAATTCTGTCATTCCT
AAAACACCCTTCAGCAATGATAATGAGCAGATGAGAGTTTCTGGATTAGCTTT
TCCTATTTTCGATGAAGTTCTGAGATACTGAAATGTGAAAAGAGCAATCAGAA
TTGTGCTTTTTCTCCCCTCCTCTATTCCTTTTAGGGAATAATATTCAATACACA
GTACTTCCTCCCAGCATTGCTACTGCTCAGCTTCTTCTTTCATTCTAATCCTTG
CTATTAAGAATTTAAGACTTGTGCTTACAATATTTTTGACCTGGAGTGGATCT
ATTTACATAGTCATTTAGGATCCATGCAGCTTTTTTTGTCTTTTTAAGATTATT
GGCTCATAAGCATATGTATACTGGTTTATGGAACTTTATTTACACTCCTCTATC
ATGCAAAAAAATTTTGACTTTTTAGTACTAAGCTTAATTTTTAAAAACAAAATC
TGTAGTGTTGACAAATAAATAGTTGCTCTTCTACACTAGGGGTTTCACCTGCA
GGTTTGACACGCAGTTGCTCGCTTTTCCTGCCCTGTCAAGCTTCTCTGTTCTG
GCGTGAGTTGTGAAAGAGTTGAAGACAGCTTCCCATGCCGGTACACAGCCAG
TAGCCTAAATCTCCAGTACTTGAGCTGACCATTGAACTAGGGCAAGTCTTAAA
TGTGTACATGTAGTTGAATTTCAGTCCTTACGGGTAAACAGATTGAGCATGGC
TCTCTATTCCCTCAGCCTAAGAAACACTCATGGGAATGCATTTGGCAACCCAA
GGAACCATTTGCTTAAACCTGGAACATCTCACCTTTTTAAATCCTAAAAAACA
CTGGCAGTTATATTTTAAATTAGTTTTTATTTTTATGATGGTTTTATCAAAAGA
CTTTTATTATTAGATTGGGACCCCCTTCAAACCTAAAAATCAAGTTATTTCCTT
TTATAATACTTTTCTTCCCCATGGAACAAATGGGATCAATTTGTGAGTTTTTTC
CTTTAATGATAACTAAAATCCCTCTAATTTCTCATTTATGCTTTTGTCTTTTTTA
TGAAATATTTCTTTTAAAAGCCCCAGTCTCACCTACGAAATATGAAGAGCAAA
AGCTGATTTTGCTTACTTGCTAAACTGTTGGGAAAGCTCTGTAGAGCATGGTT
CCAGTGAGGCCAAGATTGAAATTTGATACTAAAAAGGCCACCTAGCTTTTTGC
AGATAACAAACAAGAAAGCTATTCCAAGACTCAGATGATGCCAGCTGTCTCCC
ACGTGTGTATTATGGTTCACCAGGGGGAACTGGCAAAAGTGTGTGTGGGGAG
GGGAAGGGTGTGTGAGTGGTTCTGAGCAAATAACTACAGGGTGCCCATTACC
ACTCAAGAAGACACTTCACGTATTCTTGTATCAAATTCAATAATCTTAAACAAT
TTGTGTAGAAGTCCACAGACATCTTTCAACCACCTTTTAGGCTGCATATGGAT
TGCCAAGTCAGCATATGAGGAATTAAAGACATTGTTTTTAAAAAAAAAAAATC
ATTTAGATGCACTTTTTTGTGTGTTCTTTAAATAAATCCAAAAAAAATGTGAAA
AAAAAAA);
my @x = split //, $seq;
my $exon_breaks= "0,133,257,402,545,660,817,908,992,1178,1418,3770";
my @y = split (/,/, $exon_breaks);
sub get_exon_sequence{
my @array = ($y[0]..$y[1]);
my $exon = join "", @x[@array];
print "$exon \n";
shift @y;
}
until($y[1] eq undef){&get_exon_sequence};
I want to join an array composed of sequence that I split based on position within the array. I spent the last two hours figuring out how to do this, and this is all I came up with. It works, but Jesus:
#!/usr/bin/perl
use strict;
use warnings;
my $seq = qw(GGGCCGGCTCGCGGGCGCTGCCAGTCTCGGGCGGCGGTGTCCGGCGCG
CGGGCGGCCTGCTGGGCGGGCTGAAGGGTTAGCGGAGCACGGGCAAGGCG
GAGAGTGACGGAGTCGGCGAGCCCCCGCGGCGACAGGTTCTCTACTTAAAA
GACAATGACTACTGATGAAGGTGCCAAGAACAATGAAGAAAGCCCCACAGC
CACTGTTGCTGAGCAGGGAGAGGATATTACCTCCAAAAAAGACAGGGGAGT
ATTAAAGATTGTCAAAAGAGTGGGGAATGGTGAGGAAACGCCGATGATTGG
AGACAAAGTTTATGTCCATTACAAAGGAAAATTGTCAAATGGAAAGAAGTTT
GATTCCAGTCATGATAGAAATGAACCATTTGTCTTTAGTCTTGGCAAAGGCC
AAGTCATCAAGGCATGGGACATTGGGGTGGCTACCATGAAGAAAGGAGAGA
TATGCCATTTACTGTGCAAACCAGAATATGCATATGGCTCGGCTGGCAGTCT
CCCTAAAATTCCCTCGAATGCAACTCTCTTTTTTGAGATTGAGCTCCTTGATT
TCAAAGGAGAGGATTTATTTGAAGATGGAGGCATTATCCGGAGAACCAAACG
GAAAGGAGAGGGATATTCAAATCCAAACGAAGGAGCAACAGTAGAAATCCA
CCTGGAAGGCCGCTGTGGTGGAAGGATGTTTGACTGCAGAGATGTGGCATT
CACTGTGGGCGAAGGAGAAGACCACGACATTCCAATTGGAATTGACAAAGC
TCTGGAGAAAATGCAGCGGGAAGAACAATGTATTTTATATCTTGGACCAAGA
TATGGTTTTGGAGAGGCAGGGAAGCCTAAATTTGGCATTGAACCTAATGCTG
AGCTTATATATGAAGTTACACTTAAGAGCTTCGAAAAGGCCAAAGAATCCTG
GGAGATGGATACCAAAGAAAAATTGGAGCAGGCTGCCATTGTCAAAGAGAA
GGGAACCGTATACTTCAAGGGAGGCAAATACATGCAGGCGGTGATTCAGTAT
GGGAAGATAGTGTCCTGGTTAGAGATGGAATATGGTTTATCAGAAAAGGAAT
CGAAAGCTTCTGAATCATTTCTCCTTGCTGCCTTTCTGAACCTGGCCATGTGC
TACCTGAAGCTTAGAGAATACACCAAAGCTGTTGAATGCTGTGACAAGGCCC
TTGGACTGGACAGTGCCAATGAGAAAGGCTTGTATAGGAGGGGTGAAGCCC
AGCTGCTCATGAACGAGTTTGAGTCAGCCAAGGGTGACTTTGAGAAAGTGCT
GGAAGTAAACCCCCAGAATAAGGCTGCAAGACTGCAGATCTCCATGTGCCAG
AAAAAGGCCAAGGAGCACAACGAGCGGGACCGCAGGATATACGCCAACATG
TTCAAGAAGTTTGCAGAGCAGGATGCCAAGGAAGAGGCCAATAAAGCAATGG
GCAAGAAGACTTCAGAAGGGGTCACTAATGAAAAAGGAACAGACAGTCAAGC
AATGGAAGAAGAGAAACCTGAGGGCCACGTATGACGCCACGCCAAGGAGGG
AAGAGTCCCAGTGAACTCGGCCCCTCCTCAATGGGCTTTCCCCCAACTCAGG
ACAGAACAGTGTTTAATGTAAAGTTTGTTATAGTCTATGTGATTCTGGAAGCA
AATGGCAAAACCAGTAGCTTCCCAAAAACAGCCCCCCTGCTGCTGCCCGGAG
GGTTCACTGAGGGGTGGCACGGGACCACTCCAGGTGGAACAAACAGAAATGA
CTGTGGTGTGGAGGGAGTGAGCCAGCAGCTTAAGTCCAGCTCATTTCAGTTT
CTATCAACCTTCAAGTATCCAATTCAGGGTCCCTGGAGATCATCCTAACAATG
TGGGGCTGTTAGGTTTTACCTTTGAACTTTCATAGCACTGCAGAAACCTTTTA
AAAAAAAATGCTTCATGAATTTCTCCTTTCCTACAGTTGGGTAGGGTAGGGGA
AGGAGGATAAGCTTTTGTTTTTTAAATGACTGAAGTGCTATAAATGTAGTCTG
TTGCATTTTTAACCAACAGAACCCACAGTAGAGGGGTCTCATGTCTCCCCAGT
TCCACAGCAGTGTCACAGACGTGAAAGCCAGAACCTCAGAGGCCACTTGCTT
GCTGACTTAGCCTCCTCCCAAAGTCCCCCTCCTCAGCCAGCCTCCTTGTGAGA
GTGGCTTTCTACCACACACAGCCTGTCCCTGGGGGAGTAATTCTGTCATTCCT
AAAACACCCTTCAGCAATGATAATGAGCAGATGAGAGTTTCTGGATTAGCTTT
TCCTATTTTCGATGAAGTTCTGAGATACTGAAATGTGAAAAGAGCAATCAGAA
TTGTGCTTTTTCTCCCCTCCTCTATTCCTTTTAGGGAATAATATTCAATACACA
GTACTTCCTCCCAGCATTGCTACTGCTCAGCTTCTTCTTTCATTCTAATCCTTG
CTATTAAGAATTTAAGACTTGTGCTTACAATATTTTTGACCTGGAGTGGATCT
ATTTACATAGTCATTTAGGATCCATGCAGCTTTTTTTGTCTTTTTAAGATTATT
GGCTCATAAGCATATGTATACTGGTTTATGGAACTTTATTTACACTCCTCTATC
ATGCAAAAAAATTTTGACTTTTTAGTACTAAGCTTAATTTTTAAAAACAAAATC
TGTAGTGTTGACAAATAAATAGTTGCTCTTCTACACTAGGGGTTTCACCTGCA
GGTTTGACACGCAGTTGCTCGCTTTTCCTGCCCTGTCAAGCTTCTCTGTTCTG
GCGTGAGTTGTGAAAGAGTTGAAGACAGCTTCCCATGCCGGTACACAGCCAG
TAGCCTAAATCTCCAGTACTTGAGCTGACCATTGAACTAGGGCAAGTCTTAAA
TGTGTACATGTAGTTGAATTTCAGTCCTTACGGGTAAACAGATTGAGCATGGC
TCTCTATTCCCTCAGCCTAAGAAACACTCATGGGAATGCATTTGGCAACCCAA
GGAACCATTTGCTTAAACCTGGAACATCTCACCTTTTTAAATCCTAAAAAACA
CTGGCAGTTATATTTTAAATTAGTTTTTATTTTTATGATGGTTTTATCAAAAGA
CTTTTATTATTAGATTGGGACCCCCTTCAAACCTAAAAATCAAGTTATTTCCTT
TTATAATACTTTTCTTCCCCATGGAACAAATGGGATCAATTTGTGAGTTTTTTC
CTTTAATGATAACTAAAATCCCTCTAATTTCTCATTTATGCTTTTGTCTTTTTTA
TGAAATATTTCTTTTAAAAGCCCCAGTCTCACCTACGAAATATGAAGAGCAAA
AGCTGATTTTGCTTACTTGCTAAACTGTTGGGAAAGCTCTGTAGAGCATGGTT
CCAGTGAGGCCAAGATTGAAATTTGATACTAAAAAGGCCACCTAGCTTTTTGC
AGATAACAAACAAGAAAGCTATTCCAAGACTCAGATGATGCCAGCTGTCTCCC
ACGTGTGTATTATGGTTCACCAGGGGGAACTGGCAAAAGTGTGTGTGGGGAG
GGGAAGGGTGTGTGAGTGGTTCTGAGCAAATAACTACAGGGTGCCCATTACC
ACTCAAGAAGACACTTCACGTATTCTTGTATCAAATTCAATAATCTTAAACAAT
TTGTGTAGAAGTCCACAGACATCTTTCAACCACCTTTTAGGCTGCATATGGAT
TGCCAAGTCAGCATATGAGGAATTAAAGACATTGTTTTTAAAAAAAAAAAATC
ATTTAGATGCACTTTTTTGTGTGTTCTTTAAATAAATCCAAAAAAAATGTGAAA
AAAAAAA);
my @x = split //, $seq;
my $exon_breaks= "0,133,257,402,545,660,817,908,992,1178,1418,3770";
my @y = split (/,/, $exon_breaks);
sub get_exon_sequence{
my @array = ($y[0]..$y[1]);
my $exon = join "", @x[@array];
print "$exon \n";
shift @y;
}
until($y[1] eq undef){&get_exon_sequence};
Wednesday, February 04, 2009
Lots of people that suck
So this semester I'm taking genomics, which is cool. But we have to learn perl. Which is also cool.
Except I have no programming experience, and this is a trial-by-fire if there ever was one.
Things are going well so far, I'm just so slow. Every day is an exercise in humility.
The good news? I'm talking to Alan a lot more. He's boss.
Here's a classical "alanism" from tonight:
I was happier than Nancy Grace after finding out that the Jon Benet Ramsey case was reopened.
Hvorostovsky did a program of Tchaikovsky, Medtner, and Rachmaninoff lied. I didn't really care for the Tchaikovsky, but the Medtner alone was worth the price of admission ($70).
His sublime legato made it seem like a ventriloquist was singing the consonants. A+.
Except I have no programming experience, and this is a trial-by-fire if there ever was one.
Things are going well so far, I'm just so slow. Every day is an exercise in humility.
The good news? I'm talking to Alan a lot more. He's boss.
Here's a classical "alanism" from tonight:
i'm starting to rethink that - the midwest has its perks,
like friends
normal life
green grass
lots of people that suck, so you look cooler.
****
I was happier than Nancy Grace after finding out that the Jon Benet Ramsey case was reopened.
Hvorostovsky did a program of Tchaikovsky, Medtner, and Rachmaninoff lied. I didn't really care for the Tchaikovsky, but the Medtner alone was worth the price of admission ($70).
His sublime legato made it seem like a ventriloquist was singing the consonants. A+.
Wednesday, December 31, 2008
Much needed Berg-induced silliness, last night.
Today: caffeine-induced productivity--sitting in coffee-zone, in my beloved yet-estranged Columbia, reading interesting science and listening to Maria. Rachel always said that seemingly-profound realizations had while smoking pot decay like rotting fruit in a Peter Lynch film during the day after.
You wake up in the harsh morning light and the severe yellow-green rays of the sun reveal your foolishness like an unflattering shadow on the melancholy face of a Van Gogh.
Living in the moment? Simple pleasures? My excitement and inquisitiveness are returning after weeks of apathy and suppression.
I'm finally feeling back to normal after the nightmarish fall (cue the strident tritone double stops of a Saint Saëns violin and a staggeringly drunk Lindsey Lang, hair askew, shot in a jarring Dutch tilt).
Craig says that Mozart is the Britney Spears of classical music. I usually agree, but Entführung has some sublime moments. Overly-stylized and musically fluffy, but sublime nonetheless.
What will 2009 hold?
Today: caffeine-induced productivity--sitting in coffee-zone, in my beloved yet-estranged Columbia, reading interesting science and listening to Maria. Rachel always said that seemingly-profound realizations had while smoking pot decay like rotting fruit in a Peter Lynch film during the day after.
You wake up in the harsh morning light and the severe yellow-green rays of the sun reveal your foolishness like an unflattering shadow on the melancholy face of a Van Gogh.
Living in the moment? Simple pleasures? My excitement and inquisitiveness are returning after weeks of apathy and suppression.
I'm finally feeling back to normal after the nightmarish fall (cue the strident tritone double stops of a Saint Saëns violin and a staggeringly drunk Lindsey Lang, hair askew, shot in a jarring Dutch tilt).
Craig says that Mozart is the Britney Spears of classical music. I usually agree, but Entführung has some sublime moments. Overly-stylized and musically fluffy, but sublime nonetheless.
What will 2009 hold?
Tuesday, September 30, 2008
Sunday, September 28, 2008
Wednesday, September 10, 2008
Cosa si può dire?
Now that I am totally unpacked, my life has been (pleasantly) occupied with the mundane.
I ventured out into the world today to get a 3-hole-punch (so I can organize my binders of literature that have piled up over the last 4 years), a swingline stapler (but, the squirrels), a food processor (for the soup making), a beater/mixer set (for the imminent baking), and various other necessities.
I always tried to collect kitchen ware that was multifunctional and I could glean from a Goodwill or Salvation Army. Garlic presses, salad spinners, and cake-frosters need not apply. My only downfall to date is my juicer...a fortuitous, invaluable, and thoughtful gift from my Craigers.
I am enjoying planning meals, and perusing my cookbooks for new ideas. I think I am going to make beet soup with mascarpone brioche tomorrow.
The rest of my day was spent procrastinating, then starting, then procrastinating some more on the manuscript preparation. I am setting a goal of 6 hours of work tomorrow, and come hell or high water, it's gonna happen.
Last night I watched a documentary called "Escape from suburbia" that fleshes out, in great detail, the impending energy crisis caused by peak-oil. The urban-centered economies require transport of everything from food, water, energy, and a workforce. For a smaller metro area, this seems feasible; for places like LA, with no public transport to speak of, an influx of millions of workers to the city each day seems like an epic waste of time and energy.
It was easy to get tidal-washed with the "Inconvenient Truth"-style pandemonium of crisis-mongering, pedantic, pathetique-but the documentary actually offered some concrete solutions to the energy conundrum.
1) Subsistence agriculture has been in style for thousands of years, for one reason: food grown locally is more healthy and requires no/little transportation cost. Apart from very urbanized areas, each person in America has the capacity and ability to grow a container garden. In Missouri, I used most of the back yard for permaculture, but I realize that is not possible everywhere. In many places in Europe, families have a garden plot either next to their house (or on their roof). I think this issue really boils down to space utilization, and the unwillingness of lawn-happy, delusional yuppies to sacrifice the status symbol of manicured grass.
2) Commutes. Why? Suburban communities can create their own local economies instead of serving as the rabbit hutches for the consumer-culture zombie-fied proletariat.
3) Alternative energy. Surprisingly, the filmmakers gave this movement little credence. The fallacy that biofuels, wind, solar, and geothermal power can replace the use of fossil fuels has been perpetuated by a government that has the central goal of pacification. According to the movie, the global (read: American) society has to change it's habits before any alternative energy strategies can even make a dent in our consumption.
So what have I learned? Subsistence agriculture is always in vogue, commute as little as possible and if necessary, bike or ride public transportation. Live sustainably when ever possible. Renewable energy sources are great, but not sufficient to support our consumption rate. The government (at least the federal and state) are impervious to the drastic corrections that need occur--so deal with the city, town, or community government if you feel the need for some activism.
It's not about being "green", politically correct, or fashionable. Eco-friendly is the closest descriptor I can pick without vomiting a little in mouth.
We've veni'd and vidi'd, now its time we vici'd.
Next time: my thoughts on Scarpia, Rigoletto, Iago, Count Almaviva, and why the baritone villain is always my favorite character.
I ventured out into the world today to get a 3-hole-punch (so I can organize my binders of literature that have piled up over the last 4 years), a swingline stapler (but, the squirrels), a food processor (for the soup making), a beater/mixer set (for the imminent baking), and various other necessities.
I always tried to collect kitchen ware that was multifunctional and I could glean from a Goodwill or Salvation Army. Garlic presses, salad spinners, and cake-frosters need not apply. My only downfall to date is my juicer...a fortuitous, invaluable, and thoughtful gift from my Craigers.
I am enjoying planning meals, and perusing my cookbooks for new ideas. I think I am going to make beet soup with mascarpone brioche tomorrow.
The rest of my day was spent procrastinating, then starting, then procrastinating some more on the manuscript preparation. I am setting a goal of 6 hours of work tomorrow, and come hell or high water, it's gonna happen.
Last night I watched a documentary called "Escape from suburbia" that fleshes out, in great detail, the impending energy crisis caused by peak-oil. The urban-centered economies require transport of everything from food, water, energy, and a workforce. For a smaller metro area, this seems feasible; for places like LA, with no public transport to speak of, an influx of millions of workers to the city each day seems like an epic waste of time and energy.
It was easy to get tidal-washed with the "Inconvenient Truth"-style pandemonium of crisis-mongering, pedantic, pathetique-but the documentary actually offered some concrete solutions to the energy conundrum.
1) Subsistence agriculture has been in style for thousands of years, for one reason: food grown locally is more healthy and requires no/little transportation cost. Apart from very urbanized areas, each person in America has the capacity and ability to grow a container garden. In Missouri, I used most of the back yard for permaculture, but I realize that is not possible everywhere. In many places in Europe, families have a garden plot either next to their house (or on their roof). I think this issue really boils down to space utilization, and the unwillingness of lawn-happy, delusional yuppies to sacrifice the status symbol of manicured grass.
2) Commutes. Why? Suburban communities can create their own local economies instead of serving as the rabbit hutches for the consumer-culture zombie-fied proletariat.
3) Alternative energy. Surprisingly, the filmmakers gave this movement little credence. The fallacy that biofuels, wind, solar, and geothermal power can replace the use of fossil fuels has been perpetuated by a government that has the central goal of pacification. According to the movie, the global (read: American) society has to change it's habits before any alternative energy strategies can even make a dent in our consumption.
So what have I learned? Subsistence agriculture is always in vogue, commute as little as possible and if necessary, bike or ride public transportation. Live sustainably when ever possible. Renewable energy sources are great, but not sufficient to support our consumption rate. The government (at least the federal and state) are impervious to the drastic corrections that need occur--so deal with the city, town, or community government if you feel the need for some activism.
It's not about being "green", politically correct, or fashionable. Eco-friendly is the closest descriptor I can pick without vomiting a little in mouth.
We've veni'd and vidi'd, now its time we vici'd.
Next time: my thoughts on Scarpia, Rigoletto, Iago, Count Almaviva, and why the baritone villain is always my favorite character.
Monday, September 08, 2008
Sunday, September 07, 2008
Amuhrica, FUCK YEAH
Don't want to jinx it, but I may have some very exciting news to post about this evening.
That is all.
That is all.
Saturday, August 30, 2008
Go to the field on weekdays, have a picnic on Laborday
So I am pretty much completely obsessed with Tina Turner. I'm planning a post about the parallels between TT and Maria Callas. I don't use the F word lightly, but they are both so fierce. (I will have to watch Mad Max: Beyond Thunderdome yet again.)
But, after all, I do need some frenetic TT to get me through the last week in the Cone lab, which shaped up to be a non-stop shit-show, cluster-fuck. I was trying to finish up some last experiments so that I wouldn't have to get my coworkers to find my 4.5-years of unorganized supplies while I am 2000 miles away. So, we did finish most of the field work (I think) and I am finishing up the last experiments as we speak. So to say.
I have slept 5 hours in the last 48, but for some reason I am still going strong. Here's why: I've found that by staying out of the daylight, I can totally subvert my body's natural circadian clock. I actually caught myself purposefully not looking out the window at work today so that I would fool myself into experiencing perpetual night.
I know. That is so vampire-emo.
Some nerdery:
One of the last experiments I am doing is a real-time RT-PCR, which is a pretty powerful (if not standard) genetic technique. Basically you make cDNA from a RNA sample, and then carry out PCR with the cDNA to quantify the transcript level. Sounds pretty simple right?
In theory. But of course as Homer Simpson likes to say, "In theory communism works."
So you have to flash freeze your tissues in liq N2, grind them, extract them with trizol (that helps keep the RNases from chewing up your nucleic acids), chloroform extract the trizol, precipitate the RNA with isopropanol and salt, wash the RNA with EtOH, and resuspend it back up in DEPC H20. After each step you have to centrifuge, and remove the supernatant with a Pasteur pipette.
To keep from getting the reverse transcriptase from extending any genomic DNA contamination, and therefore negating your RNA quantification, you have to then digest your total RNA sample with DNase I, then phenol:chloroform: isoamyl-alcohol extract, and resuspend.
Then you need to carry out the RT rxn with MMLV (monkey murine reverse transcriptase), RNase inhibitor, dNTPs--then PCI extract the first strand cDNA, use spectrophotometry to determine absorbancy, and then run real time PCR in technical triplicate with endogenous controls to quantify RNA levels. I won't even go into the primer design phase, but those have to be gene-specific and optimized separately.
Ideally you would assay the integrity of your RNA and then check for inhibitors of the qPCR rxn. On a formaldehyde (denaturing gel).
The real-time PCR uses florescence to quantify the accumulation of double stranded products in real time; by including a passive reference dye and SYBR green (which binds to double stranded DNA) you can measure product after each of the 40 cycles.
I know. Pretty ridiculous, right? Considering that I didn't know how to do any of this about 5 weeks ago, I think I am doing OK.
What's next?
Considering that I've barely started on manuscript preparation, I have to somehow copy most of my lab notebooks from the last 4.5 years, and take my shitload of files.
Did I mention that I am leaving on Tuesday morning?
I plan on packing Sunday and Monday. That will be fun and exciting.
Go westward young man.
It has finally hit me that I am starting a completely new life in a state 2000 miles away where I know a handful of people. I will miss Craig and zipper so much! Not to mention the other Columbia friends L&K, Rachel, etc.
Sorry that was totally rambling, and probably mostly incoherent, but I am about to nod off into a coma for the ages, so gentle reader...goodbye for now.
But, after all, I do need some frenetic TT to get me through the last week in the Cone lab, which shaped up to be a non-stop shit-show, cluster-fuck. I was trying to finish up some last experiments so that I wouldn't have to get my coworkers to find my 4.5-years of unorganized supplies while I am 2000 miles away. So, we did finish most of the field work (I think) and I am finishing up the last experiments as we speak. So to say.
I have slept 5 hours in the last 48, but for some reason I am still going strong. Here's why: I've found that by staying out of the daylight, I can totally subvert my body's natural circadian clock. I actually caught myself purposefully not looking out the window at work today so that I would fool myself into experiencing perpetual night.
I know. That is so vampire-emo.
Some nerdery:
One of the last experiments I am doing is a real-time RT-PCR, which is a pretty powerful (if not standard) genetic technique. Basically you make cDNA from a RNA sample, and then carry out PCR with the cDNA to quantify the transcript level. Sounds pretty simple right?
In theory. But of course as Homer Simpson likes to say, "In theory communism works."
So you have to flash freeze your tissues in liq N2, grind them, extract them with trizol (that helps keep the RNases from chewing up your nucleic acids), chloroform extract the trizol, precipitate the RNA with isopropanol and salt, wash the RNA with EtOH, and resuspend it back up in DEPC H20. After each step you have to centrifuge, and remove the supernatant with a Pasteur pipette.
To keep from getting the reverse transcriptase from extending any genomic DNA contamination, and therefore negating your RNA quantification, you have to then digest your total RNA sample with DNase I, then phenol:chloroform: isoamyl-alcohol extract, and resuspend.
Then you need to carry out the RT rxn with MMLV (monkey murine reverse transcriptase), RNase inhibitor, dNTPs--then PCI extract the first strand cDNA, use spectrophotometry to determine absorbancy, and then run real time PCR in technical triplicate with endogenous controls to quantify RNA levels. I won't even go into the primer design phase, but those have to be gene-specific and optimized separately.
Ideally you would assay the integrity of your RNA and then check for inhibitors of the qPCR rxn. On a formaldehyde (denaturing gel).
The real-time PCR uses florescence to quantify the accumulation of double stranded products in real time; by including a passive reference dye and SYBR green (which binds to double stranded DNA) you can measure product after each of the 40 cycles.
I know. Pretty ridiculous, right? Considering that I didn't know how to do any of this about 5 weeks ago, I think I am doing OK.
What's next?
Considering that I've barely started on manuscript preparation, I have to somehow copy most of my lab notebooks from the last 4.5 years, and take my shitload of files.
Did I mention that I am leaving on Tuesday morning?
I plan on packing Sunday and Monday. That will be fun and exciting.
Go westward young man.
It has finally hit me that I am starting a completely new life in a state 2000 miles away where I know a handful of people. I will miss Craig and zipper so much! Not to mention the other Columbia friends L&K, Rachel, etc.
Sorry that was totally rambling, and probably mostly incoherent, but I am about to nod off into a coma for the ages, so gentle reader...goodbye for now.
Thursday, August 21, 2008
Today I just couldn't take the mounting pressure of the end of the summer blues. Finishing up all the experiments at work, writing the manuscript, making sure Stanford gets all my paperwork (tuberculosis test!?), arranging logistics for the 1,920 mile trip to Palo Alto--all without knowing where I am going to live yet--is weighing heavily on me.
Got to cook some tonight, I'm trying to use all the food I planted. That was fun. Yay for volunteer lemon basil, now If I could only tell when my green zebras were ripe...
Watched some of the Olympics again tonight. Spoiler Alert!
Even though going 1-2-3 in the men's 400 and 2-3 in the 110 highs, the crumpling of both the 4X100 teams put me in a bad mood. O cette ennui bleu dans le coeur.
Rachel and I finished the night by drinking plum-blueberry-lime smoothies and watching the US get gold in the men's beach VB. America! Fuck yeah!
I know that everything will be ok, and in the long run my worrying is unfounded and unproductive. Headline: Neurotic, ex-Lutheran, gay scientist, opera singer dies of stress-induced heart attack at 23.
But as Scarlett said, "Tomarrah is anotha day."
Got to cook some tonight, I'm trying to use all the food I planted. That was fun. Yay for volunteer lemon basil, now If I could only tell when my green zebras were ripe...
Watched some of the Olympics again tonight. Spoiler Alert!
Even though going 1-2-3 in the men's 400 and 2-3 in the 110 highs, the crumpling of both the 4X100 teams put me in a bad mood. O cette ennui bleu dans le coeur.
Rachel and I finished the night by drinking plum-blueberry-lime smoothies and watching the US get gold in the men's beach VB. America! Fuck yeah!
I know that everything will be ok, and in the long run my worrying is unfounded and unproductive. Headline: Neurotic, ex-Lutheran, gay scientist, opera singer dies of stress-induced heart attack at 23.
But as Scarlett said, "Tomarrah is anotha day."
Monday, June 23, 2008
Peoples of the earth, you have all been poisoned
Lest you, gentle reader, think that I have one whole brain, here's this:
Deejy-weejy and I came up with the gay decathlon:
1) Dressing
2) Activism
3) Gossiping
4) Underwear modeling
5) Oral sex
6) Dancing
7) Cooking
8) Sashaying
9) Hagging
10) Madonna/Tina/Whitney/Cher/Kylie/Dolly Karaoke-ing
Had a wonderful B-day.
Got to go to Ha-Ha Tonka (a made-up Indian name) with riveting company and see castle ruins, the spring, some caves (which were closed), and hiking. Also a decadent picnic. Then on to swimming and Indian food and then Sparkys. It was a fantastic and relaxing Saturday.
Sunday was spent recovering. Lots of sleeping in, gardening, dog-parking, phone-talking, and spending time with my baby Zipper and his owner Craigers.
Went to rehearsal tonight for POP and then I'm working on reading some "fun" summer reading. I'm on about 4 books at the same time. Here's what I've learned so far:
Alan Greenspan, The Age of Turbulence. Yes, he was the puppetmaster. No, I still don't get economics.
Burroughs, The Nova Express. Doing heroin and writing about gay sex leads to multiple-page ruminations about centipedes, ejaculate, and talking bugs. The Western Lands and Naked Lunch were basically the same thing.
Learning Perl. I am a complete retard and will never learn to program.
Tolstoy, Anna Karenina, 457/839. I totally understand why the peasants had to revolt and murder the milquetoast aristocracy in their sleep. I reject your bourgeoisie values, the wheels of the revolution will crush you.
Deejy-weejy and I came up with the gay decathlon:
1) Dressing
2) Activism
3) Gossiping
4) Underwear modeling
5) Oral sex
6) Dancing
7) Cooking
8) Sashaying
9) Hagging
10) Madonna/Tina/Whitney/Cher/Kylie/Dolly Karaoke-ing
Had a wonderful B-day.
Got to go to Ha-Ha Tonka (a made-up Indian name) with riveting company and see castle ruins, the spring, some caves (which were closed), and hiking. Also a decadent picnic. Then on to swimming and Indian food and then Sparkys. It was a fantastic and relaxing Saturday.
Sunday was spent recovering. Lots of sleeping in, gardening, dog-parking, phone-talking, and spending time with my baby Zipper and his owner Craigers.
Went to rehearsal tonight for POP and then I'm working on reading some "fun" summer reading. I'm on about 4 books at the same time. Here's what I've learned so far:
Alan Greenspan, The Age of Turbulence. Yes, he was the puppetmaster. No, I still don't get economics.
Burroughs, The Nova Express. Doing heroin and writing about gay sex leads to multiple-page ruminations about centipedes, ejaculate, and talking bugs. The Western Lands and Naked Lunch were basically the same thing.
Learning Perl. I am a complete retard and will never learn to program.
Tolstoy, Anna Karenina, 457/839. I totally understand why the peasants had to revolt and murder the milquetoast aristocracy in their sleep. I reject your bourgeoisie values, the wheels of the revolution will crush you.
Wednesday, June 18, 2008
O nature green unnatural mother
As I squatted dirty faced and bug spray perfumed over my legume garden this weekend, hand feeding freshly-picked snow peas into mouth, again hand feeding freshly-picked snow peas into mouth like some hunched intently focused chimpanzee slurping ants off a twig, I contemplated my opportunity for creative self-actualization.
For the past 5 years science and singing have been like rather, rinse, repeat--my sole source of fulfillment and satisfaction.
I have been taking a hiatus from singing for the last month (which might change with a chorus part in G&S's P.O.P.) to concentrate on other things.
Namely, chilling out and exercising. And gardening.
I have several plots with various themes. There is the eggplant, various peppers and tomatillo plot X2. There is the exotic tomato plot, the hybrid tomato plot, the heirloom tomato plot, the exotic leaf and head lettuce/spring garden plot, the spindly cucurbit plot. Also the 2 culinary herb plots and the aforementioned legume plot. Of course who could forget the annual bed consisting of zinnia, aster, cosmos, marigold, salvia?
I like growing things. I like being dirty.
Is this a distraction from my destiny? i thought as I sipped freshly brewed mint tea as the bruised mint so garishly green in the scalding water, released bits of floating leaf into my mouth at 9:30 PM as the last blue twilight disappeared and grass blended into my hands blended into the empty seed packets blended into that gray-blue before the real night lit by the moon takes over.
So much guilt.
For the past 5 years science and singing have been like rather, rinse, repeat--my sole source of fulfillment and satisfaction.
I have been taking a hiatus from singing for the last month (which might change with a chorus part in G&S's P.O.P.) to concentrate on other things.
Namely, chilling out and exercising. And gardening.
I have several plots with various themes. There is the eggplant, various peppers and tomatillo plot X2. There is the exotic tomato plot, the hybrid tomato plot, the heirloom tomato plot, the exotic leaf and head lettuce/spring garden plot, the spindly cucurbit plot. Also the 2 culinary herb plots and the aforementioned legume plot. Of course who could forget the annual bed consisting of zinnia, aster, cosmos, marigold, salvia?
I like growing things. I like being dirty.
Is this a distraction from my destiny? i thought as I sipped freshly brewed mint tea as the bruised mint so garishly green in the scalding water, released bits of floating leaf into my mouth at 9:30 PM as the last blue twilight disappeared and grass blended into my hands blended into the empty seed packets blended into that gray-blue before the real night lit by the moon takes over.
So much guilt.
Monday, May 05, 2008
When life opens its little raincloud of shittiness, I try to concentrate on the positive things and not let pettiness run my life.
I am so fortunate! I am young and beautiful, have amazing friends, a loving, gorgeous bf, am going the land of milk-and-honey next year for grad school. (I'm humble too.)
Insert Cher, "Ugh, you are a snob and a half."
So anyway, I'm planting this enormous garden this year, and putting in some "island of misfit toys" stuff: green zebra tomatoes, and black crimean tomatoes (they look like a big bruise). Also: 4 kinds of basil, a flower garden, an herb garden, and a cucurbit patch.
Tonight I had a radish top, granny smith apple, Parmesan cheese, lemon juice and balsamic vinaigrette salad. All in all, it was a pretty life-affirming experience.
Now I'm back off to work, practice, the gym, then home to transpose some Sibelius, and bask in the fact that yes, indeed I already graduated and don't have to worry about school (until Sept 22).
Le sigh.
I am so fortunate! I am young and beautiful, have amazing friends, a loving, gorgeous bf, am going the land of milk-and-honey next year for grad school. (I'm humble too.)
Insert Cher, "Ugh, you are a snob and a half."
So anyway, I'm planting this enormous garden this year, and putting in some "island of misfit toys" stuff: green zebra tomatoes, and black crimean tomatoes (they look like a big bruise). Also: 4 kinds of basil, a flower garden, an herb garden, and a cucurbit patch.
Tonight I had a radish top, granny smith apple, Parmesan cheese, lemon juice and balsamic vinaigrette salad. All in all, it was a pretty life-affirming experience.
Now I'm back off to work, practice, the gym, then home to transpose some Sibelius, and bask in the fact that yes, indeed I already graduated and don't have to worry about school (until Sept 22).
Le sigh.
Subscribe to:
Posts (Atom)