Oh, gentle readers. It's a typical Wednesday morning at 3AM. Where are I? At lab doing some biochemistry and listening to Kylie Minogue.
In 2002, her Fever album had just come out and I was taking Munich by storm with Alan. Memories of dancing in kunstpark ost to silly pop music. When will I see you again, sweet Munich?
I have always felt a strong affinity for southern Germany. The art, the music, the landscape, the history, the people. Is it the weltschmerz?
Today I got to have lunch with Susan Lindquist, MIT prof and the former director of the Whitehead institute. As we say "BFD": big fucking deal. Nothing codifies and distills my purpose like meeting a luminary. Arguably one of the most successful scientists I've met (and at Stanford I've met many successful scientists), Lindquist's candor and approachability was surprising.
One of the topics we discussed at length was the state of scientific education in America. Why do half of all American's not believe in evolution? A lion's share of the blame can be placed on the ivory tower and its inability or unwillingness to communicate with the general public. The rest of the blame can be placed on class room teachers who read from textbooks. There are few if any experimentalists who teach; most instructors regurgitate minutia into the gaping mouths of the baby bird student/automatons. No wonder why our country thinks science is inaccessible and boring.
But why didn't I learn about evolution until I was a junior in college? "Nothing in biology makes sense except in the light of evolution." This is disturbingly true. I've always thought that biology answers the what, where, and when, and how, but evolution answers the why. And that's usually more interesting.
Wednesday, December 16, 2009
Thursday, December 10, 2009
For he is like a refiner's fire
I've been going through a baroque phase lately and it's totally distressing me.
My favorite as of late is Vivica Genaux, this tomboyish Alaskan mezzo. She seems to have moved away from her short hair and pants role in the last few years, but boy, can she nail the fioratura. Not only can she sing a legato, her range is incredible. Not in the link I posted, but in another version of Qual guerriero in campo armato on youtube she sings from G3-C6. Seriously, people.
She does this wierd jaw-moving thing when articulating runs...it doesn't seem to be in rhythm, so I don't know what to make of it. She's fierce nonetheless.
My favorite as of late is Vivica Genaux, this tomboyish Alaskan mezzo. She seems to have moved away from her short hair and pants role in the last few years, but boy, can she nail the fioratura. Not only can she sing a legato, her range is incredible. Not in the link I posted, but in another version of Qual guerriero in campo armato on youtube she sings from G3-C6. Seriously, people.
She does this wierd jaw-moving thing when articulating runs...it doesn't seem to be in rhythm, so I don't know what to make of it. She's fierce nonetheless.
Wednesday, December 02, 2009
Ballwalking
Went to Nebraska for the annual pheasant hunting/Thanksgiving activities. It was beyond wonderful to see my family, most of whom I haven't seen since last Christmas (!). My little sisters are growing up to be such interesting, talented, and kind young women. My brother and I are fighting over if we can get them to come to NYC or SF for college, that would pretty much make my life.
The highlight of the trip was hanging out with Alan and his posse in Lincoln. His friend Jake lives in some hippy commune by the dumping ground for the Lincoln municipal parks, so we climbed around on dismantled playground equipment at dusk. Reclaimed by weeds, these cast-offs of childhoods forgotten were reminiscent of Where the Wild Things Are mixed with post-apocalyptic dystopia.
Bricktop was a bittersweet reminder of the Shatterdays of CoMO, but fun nonetheless. Someone who shall remain nameless may have lost a bet about Eddie Murphy and was forced to ballwalk to the bathroom.
I'm seriously considering becoming the master of my own destiny and moving to the city--at least for a trial period. Although still partial to Inner Sunset, I'm currently in love with the Duboce Triangle. It's true, victorian arctitecture, bay windows, hardwood floors, and vaulted cielings make me salivate. The only way I know to decide if I'm unnessesarily romanticizing SF is to take the plunge. Ballwalking, indeed.
The highlight of the trip was hanging out with Alan and his posse in Lincoln. His friend Jake lives in some hippy commune by the dumping ground for the Lincoln municipal parks, so we climbed around on dismantled playground equipment at dusk. Reclaimed by weeds, these cast-offs of childhoods forgotten were reminiscent of Where the Wild Things Are mixed with post-apocalyptic dystopia.
Bricktop was a bittersweet reminder of the Shatterdays of CoMO, but fun nonetheless. Someone who shall remain nameless may have lost a bet about Eddie Murphy and was forced to ballwalk to the bathroom.
I'm seriously considering becoming the master of my own destiny and moving to the city--at least for a trial period. Although still partial to Inner Sunset, I'm currently in love with the Duboce Triangle. It's true, victorian arctitecture, bay windows, hardwood floors, and vaulted cielings make me salivate. The only way I know to decide if I'm unnessesarily romanticizing SF is to take the plunge. Ballwalking, indeed.
Sunday, November 22, 2009
Fittingly enough, I've been listening to a lot of Dichterliebe recently. I always considered that song cycle to be the ugly stepsister of Winterreise, but it's finally growing on me.
Rachel A, a big fan of song cycles in general--especially Dichterliebe--introduced it to me the first time we hung out.
We sat on her floor on Bass street and read some of the Heine text.
Rachel A, a big fan of song cycles in general--especially Dichterliebe--introduced it to me the first time we hung out.
We sat on her floor on Bass street and read some of the Heine text.
Und sah die Nacht in deines Herzens Raum,
Und sah die Schlang', die dir am Herzen frißt,
Ich sah, mein Lieb, wie sehr du elend bist.
And saw the night in your heart's room,
And saw the viper that feeds on your heart;
I saw, my love, how truly miserable you are.
What an image!
I love the literal translation of the German, there's something
so much more raw about a language whose word for meat is
'fleisch'--literally flesh. I'll liken it to the choice between
"shacking up" and "cohabiting".
The way she spit out those words, it was obvious that the passage
had been seared into her mind. Now I know how she felt.
Sunday, November 08, 2009
Craig and Ed: a retrospective
After 4.5 years, Craig and I have decided to seperate. Although I cannot understand or agree with his decision, I can only support him in the new chapter of his life he has chosen to undertake. Here's a look back:

At Addison's, our favorite restaurant in Columbia. Where we had our first date, celebrated many birthdays and anniversaries.

At the martini bar for my 22nd birthday. Our group was just about the only people there that night. Eventually the gays started trading clothes in the bathroom, much to the horror of the middle-aged straight bartenders.

Us with our miniature schnauzer, Zipper. I never had a dog growing up, and this was my first puppy. He's spoiled rotten, but I love him more than most people in this world.

So much happening in this picture! I don't remember where we were, but Ryan and Manda can always be counted on to make the fun times.

We dressed up as a pitcher and catcher for Halloween the year the Cards won the world series (October 2006?). Took Shattered by storm that night and ruled with impunity...like always.

Craig doing one of his famous snarls. As he would always say, "Don't touch the hair pre-club." And he meant it too.

Trops formed the second member of the trifecta: dinner at Addisons, drinks at Trops, and then stumble across the street to Shattered--the only place worth going in CoMO.

At one of Robyn's house parties, Craig in a usual state of undress.

When we first starting dating, one of our favorite things to do was attend recitals at Mizzou. Sitting in the dark, watching our friends on stage. Feeling close to those you loved, a strange mix of voyeurism and gratitude at having the priveledge of sharing with the performers.
One of my best memories is sitting in the audience watching Rachel AuBuchon and Craig perform Ravel's Don Quichotte set. Two people I will always love.

Thanks for four and half wonderful years, Craig.

At Addison's, our favorite restaurant in Columbia. Where we had our first date, celebrated many birthdays and anniversaries.

At the martini bar for my 22nd birthday. Our group was just about the only people there that night. Eventually the gays started trading clothes in the bathroom, much to the horror of the middle-aged straight bartenders.

Us with our miniature schnauzer, Zipper. I never had a dog growing up, and this was my first puppy. He's spoiled rotten, but I love him more than most people in this world.

So much happening in this picture! I don't remember where we were, but Ryan and Manda can always be counted on to make the fun times.

We dressed up as a pitcher and catcher for Halloween the year the Cards won the world series (October 2006?). Took Shattered by storm that night and ruled with impunity...like always.

Craig doing one of his famous snarls. As he would always say, "Don't touch the hair pre-club." And he meant it too.

Trops formed the second member of the trifecta: dinner at Addisons, drinks at Trops, and then stumble across the street to Shattered--the only place worth going in CoMO.

At one of Robyn's house parties, Craig in a usual state of undress.

When we first starting dating, one of our favorite things to do was attend recitals at Mizzou. Sitting in the dark, watching our friends on stage. Feeling close to those you loved, a strange mix of voyeurism and gratitude at having the priveledge of sharing with the performers.
One of my best memories is sitting in the audience watching Rachel AuBuchon and Craig perform Ravel's Don Quichotte set. Two people I will always love.

Thanks for four and half wonderful years, Craig.
Tuesday, October 20, 2009
Typical Monday night
Get buzzed off a jug (!) of mimosas, listen to Idomeneo (usually not a fan of Mozart), and work on my qualifying exam practice talk for tomorrow morning.
Oh, I'm right where I belong.
Earlier this weekend, I went to Eliz's housewarming party in the Mission. After Poornima, Kich, Wally (Lia's labradoodle puppy), and I almost were sold drugs, we found out she has an amazing apartment!
Hardwood floors, fig and citrus trees in the backyard, cool neighbors with a baby. I threatened to kill her and assume her identity...which I would have to make good on if I didn't love her so much.
After getting pretty much shit-faced, we got crepes. I had banana and Nutella. Talk about the best drunk food ever.
Have I mentioned how much I love my friends?
Oh, I'm right where I belong.
Earlier this weekend, I went to Eliz's housewarming party in the Mission. After Poornima, Kich, Wally (Lia's labradoodle puppy), and I almost were sold drugs, we found out she has an amazing apartment!
Hardwood floors, fig and citrus trees in the backyard, cool neighbors with a baby. I threatened to kill her and assume her identity...which I would have to make good on if I didn't love her so much.
After getting pretty much shit-faced, we got crepes. I had banana and Nutella. Talk about the best drunk food ever.
Have I mentioned how much I love my friends?
Monday, October 12, 2009
Misanthrope in one act
Disturbed old man at bus station: Hey, get your bike off there! I was here first.
Me: Take your haldol, you crazy piece of shit.
Other bus stop patrons: [jaws dropped] ...?
And scene.
Me: Take your haldol, you crazy piece of shit.
Other bus stop patrons: [jaws dropped] ...?
And scene.
Thursday, October 01, 2009
Maybe this time, for the first time
Is an existentialist crisis precipitated by memories of Cabaret normal?
I need more structure in my life. This whole working 80 hours a week is fine, but working whenever I want is screwing with my little brain full of mush.
Looking back, I like to think that my time in CoMO was spent "being creatively fulfilled"--a goal I try to strive for. To be honest though, it was more like five years of single minded focus on escaping the midwest.
In the physical sense I knew I wanted to relocate to one of the coasts, surround myself with people smarter and more creative than me. Not to sound like a pompous ass or anything, haha.
Introspection will be the death of me.
I saw Dr. Birchler this week when he came to Stanford. It was great to see a familiar face and be reminded of a different life.
Speaking of random things: I'm teaching an entomology taxonomy course to highschoolers in two weeks! Mom is sending me my duplicates so we can do some hands on stuff with the kids. I think it's going to be a lot of fun.
Now I just have to find some live specimens. How do you politely ask your friends if they could collect fleas or cockroaches? I think those are probably the only insects that survive the peninsula's suburban sprawl.
I need more structure in my life. This whole working 80 hours a week is fine, but working whenever I want is screwing with my little brain full of mush.
Looking back, I like to think that my time in CoMO was spent "being creatively fulfilled"--a goal I try to strive for. To be honest though, it was more like five years of single minded focus on escaping the midwest.
In the physical sense I knew I wanted to relocate to one of the coasts, surround myself with people smarter and more creative than me. Not to sound like a pompous ass or anything, haha.
Introspection will be the death of me.
I saw Dr. Birchler this week when he came to Stanford. It was great to see a familiar face and be reminded of a different life.
Speaking of random things: I'm teaching an entomology taxonomy course to highschoolers in two weeks! Mom is sending me my duplicates so we can do some hands on stuff with the kids. I think it's going to be a lot of fun.
Now I just have to find some live specimens. How do you politely ask your friends if they could collect fleas or cockroaches? I think those are probably the only insects that survive the peninsula's suburban sprawl.
Friday, September 25, 2009
Une musique de cuivreaux fenêtres des incurables.
I slept in today and the perfect storm of conditions combined to promote weird dreams: sounds of the power-washing of my apartment complex, the lack of air conditioning, a mango overload from my fruit cleanse the day before.
In the dream, I was wandering through an Antebellum manor house which strangely resembled McKee gymnasium, the rehearsal space for the opera class at Mizzou. The house was uninhabited, but seemingly used as storage for antique furniture draped in white sheets.
No breeze. No wind, just hotness.
I walk up the stairs to the bathroom that has white beadboard (um which definitely did not go with the plantation style facade, but that is a story for another day). I look in the mirror over the sink and I see a different pair of eyes looking back at me. Through the mirror, the eyes are green, unblinking. That's it.
When I woke up I had a vague sense that this dream was a metaphor for being raped.
I guess that is what I get for reading Maeterlink before going to bed? As he would say, "Oh! rien n'y est à sa place."
Nothing is in it's right place.
In the dream, I was wandering through an Antebellum manor house which strangely resembled McKee gymnasium, the rehearsal space for the opera class at Mizzou. The house was uninhabited, but seemingly used as storage for antique furniture draped in white sheets.
No breeze. No wind, just hotness.
I walk up the stairs to the bathroom that has white beadboard (um which definitely did not go with the plantation style facade, but that is a story for another day). I look in the mirror over the sink and I see a different pair of eyes looking back at me. Through the mirror, the eyes are green, unblinking. That's it.
When I woke up I had a vague sense that this dream was a metaphor for being raped.
I guess that is what I get for reading Maeterlink before going to bed? As he would say, "Oh! rien n'y est à sa place."
Nothing is in it's right place.
Friday, September 11, 2009
You Lie!
Doing my best to be blissfully ignorant of the sham-debate about health care reform.
Did you seeSkeletor Nancy Pelosi's head just about snap off when Joe Wilson yelled "You Lie!" to Obama? Damn, gurl, time for a throw-down [Nancy taking off her hoop earrings and smearing vasoline on her mummy-neck].
Good for Obama for keeping his composure and taking the high road by adressing the issue. If he embodies one attribute, it's poise.
Which made me wonder, how would have previous presidents reacted?
GW: [ducks] "Oh goshdarn Dick Cheney, I thoughted that theys throwin shoes again."
Bill Clinton: "[Bites lower lip and squints into camera] It depends on what your definition of 'lie' is."
GHWB: "Read my lips: [vomits into lap of stenographer] no more lies."
Reagan: "Why you little punk. Mr Gorbachav, tear down that bastard!"
Carter: "All the major parties shall bring about the consummation of the [pulls out the tampon from between his legs which he sets on the podium] reformation."
Gerald Ford: "...I'm glad you raised that concern. In the case of Helsinki...aw, hell, this job sucks ass."
Nixon: "You goddamn cocksucker Jew-Bastard! I will prevail over all you mother-fuckers! Checkers, attack!"
LBJ: "You are letting our boys down. You are letting our boys in Vietnam down. [Unzips pants, removes penis] Look, you're not going to win this fight. Look what you're up against. [Addressing penis] Who is bigger, you or Joe Wilson? That's right."
Did you see
Good for Obama for keeping his composure and taking the high road by adressing the issue. If he embodies one attribute, it's poise.
Which made me wonder, how would have previous presidents reacted?
GW: [ducks] "Oh goshdarn Dick Cheney, I thoughted that theys throwin shoes again."
Bill Clinton: "[Bites lower lip and squints into camera] It depends on what your definition of 'lie' is."
GHWB: "Read my lips: [vomits into lap of stenographer] no more lies."
Reagan: "Why you little punk. Mr Gorbachav, tear down that bastard!"
Carter: "All the major parties shall bring about the consummation of the [pulls out the tampon from between his legs which he sets on the podium] reformation."
Gerald Ford: "...I'm glad you raised that concern. In the case of Helsinki...aw, hell, this job sucks ass."
Nixon: "You goddamn cocksucker Jew-Bastard! I will prevail over all you mother-fuckers! Checkers, attack!"
LBJ: "You are letting our boys down. You are letting our boys in Vietnam down. [Unzips pants, removes penis] Look, you're not going to win this fight. Look what you're up against. [Addressing penis] Who is bigger, you or Joe Wilson? That's right."
Monday, September 07, 2009
A day off
I haven't taken a whole day off to veg in such a long time.
I read most of the new issue of Cell...
And then I walked around in my underwear, ate raspberries, did laundry, went to the gym, drank a 2 liter of diet coke, and sang most of the baritone aria book haha. Sorry, downstairs neighbors.
I've been warming up every day for a week but today was the first day I really sang anything. Verdi, Tchaikovsky, Mozart, Verdi, Verdi, Verdi, Bizet.
Toreador indeed!
I read most of the new issue of Cell...
And then I walked around in my underwear, ate raspberries, did laundry, went to the gym, drank a 2 liter of diet coke, and sang most of the baritone aria book haha. Sorry, downstairs neighbors.
I've been warming up every day for a week but today was the first day I really sang anything. Verdi, Tchaikovsky, Mozart, Verdi, Verdi, Verdi, Bizet.
Toreador indeed!
Friday, August 28, 2009
Some of my favorite crazies
1) The goth dyke that pukes in her (incongruently) sequined purse on the midnight CalTrain. Seen her twice so far, usually this happens on a Tuesday or Wednesday. You go gurl!
Is the purse a remnant from her life before she became a goth? Did she steal it from a sorostitute for the sole purpose of holding her vomit on the ride home? Cause that would make her my hero.
2) The cougar I keep running into at Safeway at 1AM. She is often dressed like she just got off work at the strip club, I swear to god I didn't know anyone could pair dayglow spandex miniskirts and various animal print (zebra, leopard, dalmation?!) hooker heels on a regular basis. Tonight she was painfully hitting on (like usual) the poorMexi-checker: "...That's what I tell my son. Who's in college. Goodnight Darlin'. "
At least she's owning it. Next time I promise photo documentation.
3) In my apartment complex, the yuppie dad who is father to "the screamer". A child who I thought was being bludgeoned with a wasp nest full of rusty nails, but apparently "just doesn't like riding in the car". Seriously, I have never heard a kid scream like that, the first couple times I thought about calling the police.
The same drama has unfolded multiple times: the father carries the screaming child towards the minivan. The child screams. The father tries to reason with said child for various amounts of time. Child still screams. Repeat ad naseum.
I hope the kid is autistic or has some nerve disorder. I've contemplated leaving a note on the winshield imploring them to seek counseling. Or maybe quit sodomizing their child in the minivan? I haven't decided yet.
4) Lenny, our upstairs neighbor from the house on Crestmere. World champion kickboxer (seriously), personal trainer, salsa dance instructor, loud porn enthusiast. Every day the salsa music would play for hours. Then quiet for a few moments. Cue the loud porn for about 5 minutes. Lather, rinse, repeat.
5) No one can top the crazy that lived next door at U-Place in CoMO. We called him the mathematician. He was a conspiracy theorist and watched FOX news and argued loudly with the TV every night. And he was a big crazy face mathematician. John Nash style, but on meth.
All of these crazy faces: "puking dyke", "Safeway cougar", "yuppie dad/screamer", Lenny, and the "mathematician" have made my life more interesting in their own way.
And for that I would like to say thank you.
Is the purse a remnant from her life before she became a goth? Did she steal it from a sorostitute for the sole purpose of holding her vomit on the ride home? Cause that would make her my hero.
2) The cougar I keep running into at Safeway at 1AM. She is often dressed like she just got off work at the strip club, I swear to god I didn't know anyone could pair dayglow spandex miniskirts and various animal print (zebra, leopard, dalmation?!) hooker heels on a regular basis. Tonight she was painfully hitting on (like usual) the poorMexi-checker: "...That's what I tell my son. Who's in college. Goodnight Darlin'. "
At least she's owning it. Next time I promise photo documentation.
3) In my apartment complex, the yuppie dad who is father to "the screamer". A child who I thought was being bludgeoned with a wasp nest full of rusty nails, but apparently "just doesn't like riding in the car". Seriously, I have never heard a kid scream like that, the first couple times I thought about calling the police.
The same drama has unfolded multiple times: the father carries the screaming child towards the minivan. The child screams. The father tries to reason with said child for various amounts of time. Child still screams. Repeat ad naseum.
I hope the kid is autistic or has some nerve disorder. I've contemplated leaving a note on the winshield imploring them to seek counseling. Or maybe quit sodomizing their child in the minivan? I haven't decided yet.
4) Lenny, our upstairs neighbor from the house on Crestmere. World champion kickboxer (seriously), personal trainer, salsa dance instructor, loud porn enthusiast. Every day the salsa music would play for hours. Then quiet for a few moments. Cue the loud porn for about 5 minutes. Lather, rinse, repeat.
5) No one can top the crazy that lived next door at U-Place in CoMO. We called him the mathematician. He was a conspiracy theorist and watched FOX news and argued loudly with the TV every night. And he was a big crazy face mathematician. John Nash style, but on meth.
All of these crazy faces: "puking dyke", "Safeway cougar", "yuppie dad/screamer", Lenny, and the "mathematician" have made my life more interesting in their own way.
And for that I would like to say thank you.
Wednesday, August 26, 2009
I just found out that RepBase, a service of Genetic Information Research Institute, which I have been using for the past few months, is based in Mountain View.
A mile from my house off of Rengstorff, actually right next to Google.
RepBase is some bizarre database of repetitive elements, seemingly curated for free.
WTF.
Update: Agilent moved out of their office in Palo Alto, so Facebook moved in. I live within 5 miles of Google, Yahoo, Facebook, Pacific Biosciences, Affymetrix, and Roche.
Oh, and NASA's just down the street.
A mile from my house off of Rengstorff, actually right next to Google.
RepBase is some bizarre database of repetitive elements, seemingly curated for free.
WTF.
Update: Agilent moved out of their office in Palo Alto, so Facebook moved in. I live within 5 miles of Google, Yahoo, Facebook, Pacific Biosciences, Affymetrix, and Roche.
Oh, and NASA's just down the street.
Wednesday, August 19, 2009
New kicks
Here is a list of the new things I'm obsessed with:
1) Madonna vs Lady Gaga vs Pitbull triple mashup. Epic.
2) Being at work for 24 hours straight, and then sleeping during the daylight.
3) These shoes:

Which are the blue version of these (which I have worn to tattered shreds):

Normally I try to avoid consumerism in all forms, but Gola knows my weak spot: shiny, bright-colored weapons of awesomeness.
4) Viruses that infected a wasp, have inserted themselves into the wasp nuclear genome, but then the wasp hijacked the viral protein for packaging of its own DNA which it injects into caterpillars to suppress the caterpillar's immune system so the wasp larvae can eat the host alive from the inside out. Also picking out completely unfeasible qualifying exam topics.
5) Verdi's Macbeth. Either the 1952 Callas La Scala or the 1976 Verrett La Scala version.
6) Visiting Mike and Jennifer in the city and then looking at Craigslist apartments in the Sunset and pretending that I am living there.
1) Madonna vs Lady Gaga vs Pitbull triple mashup. Epic.
2) Being at work for 24 hours straight, and then sleeping during the daylight.
3) These shoes:

Which are the blue version of these (which I have worn to tattered shreds):

Normally I try to avoid consumerism in all forms, but Gola knows my weak spot: shiny, bright-colored weapons of awesomeness.
4) Viruses that infected a wasp, have inserted themselves into the wasp nuclear genome, but then the wasp hijacked the viral protein for packaging of its own DNA which it injects into caterpillars to suppress the caterpillar's immune system so the wasp larvae can eat the host alive from the inside out. Also picking out completely unfeasible qualifying exam topics.
5) Verdi's Macbeth. Either the 1952 Callas La Scala or the 1976 Verrett La Scala version.
6) Visiting Mike and Jennifer in the city and then looking at Craigslist apartments in the Sunset and pretending that I am living there.
Friday, August 14, 2009
Went over to Jay and Lia's house with Diane tonight to help put together a rough sketch of a garden plan for their new backyard..while sipping a chardonnay. She knows how to make a gay happy!
Since everyone my age is a heathen, that eliminates religion from the politics-and-religion bipartite of impolite dinner conversation. Recently, it seems like I've been having the same conversation over and over. Namely, the definition of libertarianism. Words are words, but Jesus tap-dancing Christ. People might have more of a clue I said I am a closet Royalist (which I am). I concede to an extent terms like conservative, progressive, or reformist are all meaningless without a reference point. I think my commie hero Pete Seeger said it best:
"I like to say I'm more conservative than Goldwater. He just wanted to turn the clock back to when there was no income tax. I want to turn the clock back to when people lived in small villages and took care of each other."
Words are words, right? I'm trying to come up with a succinct one-liner that describes my fringe camp. It used to be "the party Party: you know, for legalization of drugs and elimination of taxes". I'm realizing it boils down to something less tangible: the dismantling of the nanny-state and the overthrow of American empiricism.
Two weeks from now marks the anniversary of my moving to NorCal. Until the day that I can live in NYC, I'll have to make do with San Fran...or 30 miles south of it...sigh. A west coast version of:
My little town blues are melting away, I'll make a brand new start of it, in old New York. If I can make it there, I'll make it anywhere!
Is my self satisfied delusion of grandeur vomit-inducing, or what?
Will my life be shaped by the rebellion against those little town blues? Will I never stop until I have a morphed into some pathetic hipster with super low V-necks, a fedora, squarish 80s sunglasses, who walks my dog in the Castro while holding hands with my boyfriend?
Actually, that doesn't sound that bad. Just no double stroller filled with ethnic babies bought with ipod bribes like in Bruno.
Since everyone my age is a heathen, that eliminates religion from the politics-and-religion bipartite of impolite dinner conversation. Recently, it seems like I've been having the same conversation over and over. Namely, the definition of libertarianism. Words are words, but Jesus tap-dancing Christ. People might have more of a clue I said I am a closet Royalist (which I am). I concede to an extent terms like conservative, progressive, or reformist are all meaningless without a reference point. I think my commie hero Pete Seeger said it best:
"I like to say I'm more conservative than Goldwater. He just wanted to turn the clock back to when there was no income tax. I want to turn the clock back to when people lived in small villages and took care of each other."
Words are words, right? I'm trying to come up with a succinct one-liner that describes my fringe camp. It used to be "the party Party: you know, for legalization of drugs and elimination of taxes". I'm realizing it boils down to something less tangible: the dismantling of the nanny-state and the overthrow of American empiricism.
Two weeks from now marks the anniversary of my moving to NorCal. Until the day that I can live in NYC, I'll have to make do with San Fran...or 30 miles south of it...sigh. A west coast version of:
My little town blues are melting away, I'll make a brand new start of it, in old New York. If I can make it there, I'll make it anywhere!
Is my self satisfied delusion of grandeur vomit-inducing, or what?
Will my life be shaped by the rebellion against those little town blues? Will I never stop until I have a morphed into some pathetic hipster with super low V-necks, a fedora, squarish 80s sunglasses, who walks my dog in the Castro while holding hands with my boyfriend?
Actually, that doesn't sound that bad. Just no double stroller filled with ethnic babies bought with ipod bribes like in Bruno.
Thursday, June 25, 2009
My 10 favorite famous people
Tina Turner (R&R singer/actress)
William Burroughs (homosexual writer)
Bette Davis (fierce actress)
Gregor Mendel (geneticist)
Barbara McClintock (geneticist)
Maria Callas (opera singer)
Charles Darwin (scientist)
Guiseppe Verdi (composer)Charles Ives (composer)
Deitrich Fischer-Dieskau (singer)
Francis Poulenc (composer)
William Burroughs (homosexual writer)
Bette Davis (fierce actress)
Gregor Mendel (geneticist)
Barbara McClintock (geneticist)
Maria Callas (opera singer)
Charles Darwin (scientist)
Deitrich Fischer-Dieskau (singer)
Francis Poulenc (composer)
Wednesday, June 24, 2009
Tosca, mi fai dimenticare Iddio!
Craig came into town for the weekend and here's what happened:
Friday: went to get Indian food and tried my best to die from an acute peanut allergic reaction. Forgot to give Craig the key and my phone is lost and his phone was dead, so I couldn't call him, so I sat in the ER waiting room while he ate ice cream outside my front door, until we finally met at 10PM. And by then, I just crawled in bed and tried to sleep off what felt like a stampede of water buffaloes across my stomach. Good times!
Saturday and Sunday we got to hang out and enjoying picnicking and brunch. Drank enough mimosas to awaken said water buffaloes and had to sleep off an impending hangover by the pool. What a hard life.
Monday: trip to San Francisco and the California Academy of Sciences (where nerds go to have fun), the musee mechanique (very touristy, but full of fabulously disturbing player pianos), tour a real retired WWII submarine in the harbor (just thinking about all those sweaty sailors stuck down there for 75 days made me want to have a smoke afterwards...and I don't smoke), go thrifting at the apty named thrift-town (where I got bambo shaped tumblers and matching blue willow patterned Japanese stoneware...recycle, reuse, reduce in action), and swing by El Farolito (my favorite hole-in-the-wall Mexican in the Mission).
Back in PA, we went to the Nut House (despite all my recent adverse peanut experiences) where Craig got to meet more of my grad school friends and get most of the way hammered.
All in all, a pretty fantastic birthday!
I also got to spend a lot of down time with my sweetest baby Craiger, reaffirming a love for my very own life-sized hunky ken-doll.
This week will be spent reading everything I can get my hands on concerning DNA replication timing, human repetitive elements, and nuclear compartmentalization. Yay for exciting science.
What will 24 have in store?
Is it time to quote Fried Green Tomatoes: "Face it girls, I'm older and have more insurance"?
Friday: went to get Indian food and tried my best to die from an acute peanut allergic reaction. Forgot to give Craig the key and my phone is lost and his phone was dead, so I couldn't call him, so I sat in the ER waiting room while he ate ice cream outside my front door, until we finally met at 10PM. And by then, I just crawled in bed and tried to sleep off what felt like a stampede of water buffaloes across my stomach. Good times!
Saturday and Sunday we got to hang out and enjoying picnicking and brunch. Drank enough mimosas to awaken said water buffaloes and had to sleep off an impending hangover by the pool. What a hard life.
Monday: trip to San Francisco and the California Academy of Sciences (where nerds go to have fun), the musee mechanique (very touristy, but full of fabulously disturbing player pianos), tour a real retired WWII submarine in the harbor (just thinking about all those sweaty sailors stuck down there for 75 days made me want to have a smoke afterwards...and I don't smoke), go thrifting at the apty named thrift-town (where I got bambo shaped tumblers and matching blue willow patterned Japanese stoneware...recycle, reuse, reduce in action), and swing by El Farolito (my favorite hole-in-the-wall Mexican in the Mission).
Back in PA, we went to the Nut House (despite all my recent adverse peanut experiences) where Craig got to meet more of my grad school friends and get most of the way hammered.
All in all, a pretty fantastic birthday!
I also got to spend a lot of down time with my sweetest baby Craiger, reaffirming a love for my very own life-sized hunky ken-doll.
This week will be spent reading everything I can get my hands on concerning DNA replication timing, human repetitive elements, and nuclear compartmentalization. Yay for exciting science.
What will 24 have in store?
Is it time to quote Fried Green Tomatoes: "Face it girls, I'm older and have more insurance"?
Tuesday, June 16, 2009
Drinking and oath, and smutty jest
I haven't been this happy in a long time. I think I have finally settled in to the whole grad school thing, have a support net, still long to live in glamorous SF, etc.
The past couple months have been an extraordinary surge of (scientific) creativity and fulfillment. I can't remember the last time that I was this excited about science.
I have picked a thesis lab and start next week (after my birthday, the big 2-4).
And yet, a little of me is missing. My Craiger and my zipper are still living in Missouri, and although he is coming to visit this weekend, he will have to go back on Tuesday. When we finally live together, I wonder if I will appreciate it after being apart so long? Will I get used to coming home before it's dark every night? Will I get a motorcycle so I can keep up with by BF who is now officially a biker daddy?
One thing is for sure: I have found a group of friends that make me happy, and I hope I do the same for them. This weekend we hung out at an out-of-town profs house. Drinking ensued, and Lia and I may or may not have cross-dressed and posed with said professor's Lasker.
The past couple months have been an extraordinary surge of (scientific) creativity and fulfillment. I can't remember the last time that I was this excited about science.
I have picked a thesis lab and start next week (after my birthday, the big 2-4).
And yet, a little of me is missing. My Craiger and my zipper are still living in Missouri, and although he is coming to visit this weekend, he will have to go back on Tuesday. When we finally live together, I wonder if I will appreciate it after being apart so long? Will I get used to coming home before it's dark every night? Will I get a motorcycle so I can keep up with by BF who is now officially a biker daddy?
One thing is for sure: I have found a group of friends that make me happy, and I hope I do the same for them. This weekend we hung out at an out-of-town profs house. Drinking ensued, and Lia and I may or may not have cross-dressed and posed with said professor's Lasker.
Wednesday, May 20, 2009
Creature of the night
My nocturnal state has once again reared its ugly head. The relative absence of classwork commitments coupled with my flexible hours as a scientist extraordinaire has caused my whole-sale shift from the diurnal schedule on which the rest of the world operates.
This has been a longstanding struggle. Ever since I was a child I was always a night owl. Recent experiments show that ex-vivo cell lines of extreme larks or night owls maintain their altered circadian rhythm as assayed by florescent reporters. So I am biologically justified in bizarre habit.
I always used to dream of becoming an entomologist that studied moths so I would have an excuse to stay up late. Watching Dave Attell's Insomniac proves conclusively that the late night folk are way more interesting anyway.
Today we will see if I can get back on track. Not so much out of necessity, but just out of principle. Here goes cold turkey: twitching, sweating, the whole nine yards.

Update: By the way, epic fail.
This has been a longstanding struggle. Ever since I was a child I was always a night owl. Recent experiments show that ex-vivo cell lines of extreme larks or night owls maintain their altered circadian rhythm as assayed by florescent reporters. So I am biologically justified in bizarre habit.
I always used to dream of becoming an entomologist that studied moths so I would have an excuse to stay up late. Watching Dave Attell's Insomniac proves conclusively that the late night folk are way more interesting anyway.
Today we will see if I can get back on track. Not so much out of necessity, but just out of principle. Here goes cold turkey: twitching, sweating, the whole nine yards.

Update: By the way, epic fail.
Sunday, May 17, 2009
For God knows how long, I have been morbidly fascinated with LBJ and Lady Byrd.
Today as I picked out tomato, pepper, and tomatillo plants for my garden, I was reminded of Lady Byrd's fervent support of highway beautification saying, "And ahn evreh street coh-nuh, there woood be a shuh-rooob."
My grandpa lived through the Johnson administration, and always joked that highway beautification should be "riding with the top of the convertible up so no one would have to look at Lady Bird's ugly daughters".
The genteel Lady Bird was also a strong woman, one of the few who could reason with her heavy-handed husband. Against the wishes of LBJ, she used her inhertence to invest in radio and television stations in Texas, ammassing a $150 million dollar empire.
Playing second fiddle to Jackie Kennedy, devoted to her brutish and filandering husband, Lady Bird strikes a tragic yet stoic figure. Enduring the scorn of her contemporary liberals, Lady Bird--revisionist history notwithstanding--remains one of the most influential first ladies.
Despite their outdated gender construction, first ladies hold a special place in my heart. That's why Theresa Heinz Kerry would have never done: her eccentric accent and silk scarves were just too much for an America weaned on graciousness and accessibility.
Michelle Obama, seemingly overcoming her "strange mix of priviledge and victimology", has already won me over by planting a garden outside the Whitehouse. It's true, the path to my heart is through subsistence agriculture.
Today as I picked out tomato, pepper, and tomatillo plants for my garden, I was reminded of Lady Byrd's fervent support of highway beautification saying, "And ahn evreh street coh-nuh, there woood be a shuh-rooob."
My grandpa lived through the Johnson administration, and always joked that highway beautification should be "riding with the top of the convertible up so no one would have to look at Lady Bird's ugly daughters".
The genteel Lady Bird was also a strong woman, one of the few who could reason with her heavy-handed husband. Against the wishes of LBJ, she used her inhertence to invest in radio and television stations in Texas, ammassing a $150 million dollar empire.
Playing second fiddle to Jackie Kennedy, devoted to her brutish and filandering husband, Lady Bird strikes a tragic yet stoic figure. Enduring the scorn of her contemporary liberals, Lady Bird--revisionist history notwithstanding--remains one of the most influential first ladies.
Despite their outdated gender construction, first ladies hold a special place in my heart. That's why Theresa Heinz Kerry would have never done: her eccentric accent and silk scarves were just too much for an America weaned on graciousness and accessibility.
Michelle Obama, seemingly overcoming her "strange mix of priviledge and victimology", has already won me over by planting a garden outside the Whitehouse. It's true, the path to my heart is through subsistence agriculture.
Friday, May 15, 2009
I used to think it was foolish to pander to Middle America: "We're just like anyone else, living in committed, monogamous relationships" or "We deserve the pursuit of happiness".
These arguments are intrinsically flawed because they seek the sanction of the heterosexual oppressors. I know I'm being dramatic, but did reasoning with the plantation owner emancipate the slaves? The "arc of justice"--it's now fashionable again to quote MLK--is usually steered by the courts not the electorate.
The more I think about it, I'm not sure if I like the direction of the contemporary LGBT movement.
Chasing after the double-strollered suburban dream somehow negates the long history of gay counter culture. I'm confused. Are we saying we want to be like everyone else, or we want everyone else to be like us?
When GLAAD protests the portrayals of lesbians in "Basic Instinct" or gay promiscuity in "Crusing" I want to stomp my feet and scream, "Who cares?!". When the day comes that dykes can't be sensual murderesses or fags can't be sweaty cock-fiends it's the day I get off this motherfucking train.
Supposedly, the movement dropped NAMBLA as a liability along the way. I guess distancing themselves from pedophiles served their purpose, but when will the assimilation stop?
The sad part? I would rather have gay marriage banned in all states immediately and see that mental midget with the plastic tits be the poster child of the intellectual meritocracy than have snivelling Perez Hilton be a flag bearer for the LGBT cause.
Opposite marriage indeed.
These arguments are intrinsically flawed because they seek the sanction of the heterosexual oppressors. I know I'm being dramatic, but did reasoning with the plantation owner emancipate the slaves? The "arc of justice"--it's now fashionable again to quote MLK--is usually steered by the courts not the electorate.
The more I think about it, I'm not sure if I like the direction of the contemporary LGBT movement.
Chasing after the double-strollered suburban dream somehow negates the long history of gay counter culture. I'm confused. Are we saying we want to be like everyone else, or we want everyone else to be like us?
When GLAAD protests the portrayals of lesbians in "Basic Instinct" or gay promiscuity in "Crusing" I want to stomp my feet and scream, "Who cares?!". When the day comes that dykes can't be sensual murderesses or fags can't be sweaty cock-fiends it's the day I get off this motherfucking train.
Supposedly, the movement dropped NAMBLA as a liability along the way. I guess distancing themselves from pedophiles served their purpose, but when will the assimilation stop?
The sad part? I would rather have gay marriage banned in all states immediately and see that mental midget with the plastic tits be the poster child of the intellectual meritocracy than have snivelling Perez Hilton be a flag bearer for the LGBT cause.
Opposite marriage indeed.
Friday, April 10, 2009
Walk. Now walk.
Yay for drinking mimosas at work on a Friday afternoon and then grinding worms while listening to RuPaul's "Cover Girl (Put the Bass in Your Walk)" when totally buzzed.
Later tonight we're having a Seder celebration (Go Jew Party!).
I love Stanford.
Later tonight we're having a Seder celebration (Go Jew Party!).
I love Stanford.
Wednesday, April 08, 2009
The atmosphere is very Macbeth-ish. What has, or is about to happen?
Just read an article about the United States Secretary of Education Arne Duncan.
The former CEO of Chicago's public schools, apparently tried his best to rescue the crumbling system with of all things (gasp!) accountability. Although short on specifics, the article details his approach of natural selection to weed out underperforming (PC speak for "shitty") schools. Not a popular choice with teacher's unions--who despite professing valuation of students' education, continue to openly sabotage even the smallest whiff of reform--the strategy is vaguely reminiscent of ermm...the free market.
I should quit my day job and become an oracle: Duncan--heavy on rhetoric and light on action--a mid-forties, attractive, glorified Chicago bureaucrat, Harvard grad (sound familiar yet?) will fail to deliver on 90% of his promises.
I'll be honest, I have a grudge against public (K-12) education. I had numerous excellent teachers in the small town I grew up in; I will always remember those that changed my life for the better: Jeff Sandquist (my choir teacher), Mary Wilkerson (my AP Calc teacher), Mrs. Hammond (my chemistry teacher), Mrs. Ewing (my American Lit teacher). I was more fortunate than inner city Chicago kids.
But most of my time from the age of 5 to 18 was wasted by ineffective, incompetent, uninspired, and uninspiring lifers. These are the parasites that make up the bulk of teachers' unions.
As of late I have recessed from a rabid fascination with politics and public policy. It makes my blood boil to think about how the faux distinct Republidemocrats are flushing my beloved country down the toilet with their imperialism and grandiose redistribution of wealth.
My instinct is to play the violin as Rome burns, but something is amiss.
I finally put my finger on it. From far away, the farce called America provides better entertainment than RuPaul's Drag Race. Close up, it's too grotesque to watch.
[Edit: Thank god for Iowa?! I never thought I would say that.]
The former CEO of Chicago's public schools, apparently tried his best to rescue the crumbling system with of all things (gasp!) accountability. Although short on specifics, the article details his approach of natural selection to weed out underperforming (PC speak for "shitty") schools. Not a popular choice with teacher's unions--who despite professing valuation of students' education, continue to openly sabotage even the smallest whiff of reform--the strategy is vaguely reminiscent of ermm...the free market.
I should quit my day job and become an oracle: Duncan--heavy on rhetoric and light on action--a mid-forties, attractive, glorified Chicago bureaucrat, Harvard grad (sound familiar yet?) will fail to deliver on 90% of his promises.
I'll be honest, I have a grudge against public (K-12) education. I had numerous excellent teachers in the small town I grew up in; I will always remember those that changed my life for the better: Jeff Sandquist (my choir teacher), Mary Wilkerson (my AP Calc teacher), Mrs. Hammond (my chemistry teacher), Mrs. Ewing (my American Lit teacher). I was more fortunate than inner city Chicago kids.
But most of my time from the age of 5 to 18 was wasted by ineffective, incompetent, uninspired, and uninspiring lifers. These are the parasites that make up the bulk of teachers' unions.
As of late I have recessed from a rabid fascination with politics and public policy. It makes my blood boil to think about how the faux distinct Republidemocrats are flushing my beloved country down the toilet with their imperialism and grandiose redistribution of wealth.
My instinct is to play the violin as Rome burns, but something is amiss.
I finally put my finger on it. From far away, the farce called America provides better entertainment than RuPaul's Drag Race. Close up, it's too grotesque to watch.
[Edit: Thank god for Iowa?! I never thought I would say that.]
Thursday, April 02, 2009
Utterly disturbing realization #586,359

Young Stalin was hot! Look at Miss Joseph work that scarf and Guido hair!
At this point he was a 5'4", pockmarked, former seminary student and soon-to-be p
Slap a pair of X-ist briefs on this 24-year old Uncle Joe and he could go work for Michael Lucas.
Tuesday, March 31, 2009
Cher: Would you call me shallow? Dion: No. Not to your face.
Shopping for clothes: Cher from Clueless:: Shopping for antibodies: Me.
How much of a nerd am I?
Abcam, Novus, Upstate (now owned by Millipore, who knew?) have made me want to go into biotech instead of academia.
Dolla, Dolla billz, y'all.
How much of a nerd am I?
Abcam, Novus, Upstate (now owned by Millipore, who knew?) have made me want to go into biotech instead of academia.
Dolla, Dolla billz, y'all.
Monday, March 23, 2009
I have meaning to write about this for a long time...but never could really bring myself to actually do a post about Michael Lucas.
He's the bratty child in the grocery store who throws a foot-stomping tantrum. And instead of his yuppie mother leaning over and politely asking him to share his feelings, she should unwaveringly bludgeon him with the nearest piece of produce, ideally a unripe pineapple.
Giving him any attention and then lamenting his overexposure (pun definitely intended) is a delicate tightrope act, so I'll do my best.
For those of you who don't know, Michael Lucas is a gay porn kingpin originally from mother Russia, but currently based in NYC. I have read his blog (warning NSFW, read: this means you Bees!) with eagerness for about four years. Never one to miss even the most banal opportunity for publicity, Michael without fail posts links to the various D-list magazines willing to stoop low enough to interview him..and usually take pictures of his disgusting dick/him wearing high-end fashion designed to distract us from his Zoolander lips.
From Michael I learned about anal douching, the dangers of barebacking, the safety of oral cumshots, and a slew of other non-porn related topics.
Believe it or not, the most interesting part of reading his blog is learning about his political views. He is so refreshingly un-PC-- in a world full of queens watching what they say at every turn, it is nice to have some frankly offensive "straight" talk. Most of Michael's political views are driven by his unashamed support of all things Israel and his uncompromising gay agenda.
As I remember, he was very tough on Hillary Clinton, the seemingly unchallenged darling of the LBGT community during the 2008 presidentialfarce race. Hillary is the ultimate two-faced Janus of a politician, and Michael calling her out on cockteasing the queer electorate won him points in my book.
I cannot tell you how hard I laughed when I read his interpretation of California's passing of prop 8 in an entry entitled The Mormon-Black Axis of Hate. Provocateur or serious? You be the judge.
Always one to use his perspective as an immigrant from the crumbling Soviet Union, Michael often comments on US fiscal policy:
All of this government “help” is making me concerned that this country is moving towards socialism, which I so happily escaped. The government is not your loving mother who will come and rescue you from any situation you've put yourself in.
Jumping at any chance to slam Islam, Iran, or Saudia Arabia, Michael never lets anyone forget that he's a Jew. And that homosexuals are discriminated against and often executed throughout the middle east, Israel being the shining exception.
But what is the real reason that anyone puts up with all his self-aggrandizing vitriol? He's holding daddly-licious Wilfried Knight hostage.


Nevertheless, I find Michael's blog captivating, reading it with bated breath everyday like a jury looking at autopsy photos through spread finders.
When he's ready to brunch with me and discuss coming out of the closet as a fiscal conservative, I'll be waiting.
He's the bratty child in the grocery store who throws a foot-stomping tantrum. And instead of his yuppie mother leaning over and politely asking him to share his feelings, she should unwaveringly bludgeon him with the nearest piece of produce, ideally a unripe pineapple.
Giving him any attention and then lamenting his overexposure (pun definitely intended) is a delicate tightrope act, so I'll do my best.
For those of you who don't know, Michael Lucas is a gay porn kingpin originally from mother Russia, but currently based in NYC. I have read his blog (warning NSFW, read: this means you Bees!) with eagerness for about four years. Never one to miss even the most banal opportunity for publicity, Michael without fail posts links to the various D-list magazines willing to stoop low enough to interview him..and usually take pictures of his disgusting dick/him wearing high-end fashion designed to distract us from his Zoolander lips.
From Michael I learned about anal douching, the dangers of barebacking, the safety of oral cumshots, and a slew of other non-porn related topics.
Believe it or not, the most interesting part of reading his blog is learning about his political views. He is so refreshingly un-PC-- in a world full of queens watching what they say at every turn, it is nice to have some frankly offensive "straight" talk. Most of Michael's political views are driven by his unashamed support of all things Israel and his uncompromising gay agenda.
As I remember, he was very tough on Hillary Clinton, the seemingly unchallenged darling of the LBGT community during the 2008 presidential
I cannot tell you how hard I laughed when I read his interpretation of California's passing of prop 8 in an entry entitled The Mormon-Black Axis of Hate. Provocateur or serious? You be the judge.
Always one to use his perspective as an immigrant from the crumbling Soviet Union, Michael often comments on US fiscal policy:
All of this government “help” is making me concerned that this country is moving towards socialism, which I so happily escaped. The government is not your loving mother who will come and rescue you from any situation you've put yourself in.
Jumping at any chance to slam Islam, Iran, or Saudia Arabia, Michael never lets anyone forget that he's a Jew. And that homosexuals are discriminated against and often executed throughout the middle east, Israel being the shining exception.
But what is the real reason that anyone puts up with all his self-aggrandizing vitriol? He's holding daddly-licious Wilfried Knight hostage.


Nevertheless, I find Michael's blog captivating, reading it with bated breath everyday like a jury looking at autopsy photos through spread finders.
When he's ready to brunch with me and discuss coming out of the closet as a fiscal conservative, I'll be waiting.
Monday, March 16, 2009
Glück das mir verblieb
What a fantastic whirlwind the past few days have been.
Last week was the last "real" week of the quarter. The perl continued to eat my soul to the very end. The last few days before my project was due were spent lying in bed (like some Victorian invalid) , surrounded by tea service, curtains drawn, continuously coding.
But it is done, and as soon as I finished, the jagged and strident circus music--as if piped through a tin can directly into my atrophied brain--stopped.
On Sunday, to my delight, I went barrel tasting with Lia, Jay, Biff, Jan, et al to Sonoma. Needless to say the escape from the utter monotony of pedestrian faux-chic Palo Alto was appreciated. A wonderful day spent in the NorCal countryside sipping ports, merlots, cab savs, and pinots. Totally burned out on red wine for the time being.
Despite a rather bizarre day on campus, two facts remain: the in vitro chromatin assembly worked, and I'm fuckitty-fucking done with genomics!
Craig is visiting/job-hunting next week, so I will get to see my baby and enjoy spring break.
Last week was the last "real" week of the quarter. The perl continued to eat my soul to the very end. The last few days before my project was due were spent lying in bed (like some Victorian invalid) , surrounded by tea service, curtains drawn, continuously coding.
But it is done, and as soon as I finished, the jagged and strident circus music--as if piped through a tin can directly into my atrophied brain--stopped.
On Sunday, to my delight, I went barrel tasting with Lia, Jay, Biff, Jan, et al to Sonoma. Needless to say the escape from the utter monotony of pedestrian faux-chic Palo Alto was appreciated. A wonderful day spent in the NorCal countryside sipping ports, merlots, cab savs, and pinots. Totally burned out on red wine for the time being.
Despite a rather bizarre day on campus, two facts remain: the in vitro chromatin assembly worked, and I'm fuckitty-fucking done with genomics!
Craig is visiting/job-hunting next week, so I will get to see my baby and enjoy spring break.
Wednesday, March 11, 2009
Dolly Parton and Jennifer Holliday make life worth living.
I had a really good day today. That is all.
I had a really good day today. That is all.
Monday, February 09, 2009
head full of straw
Fuck you perl! Why is this so hard?
I want to join an array composed of sequence that I split based on position within the array. I spent the last two hours figuring out how to do this, and this is all I came up with. It works, but Jesus:
#!/usr/bin/perl
use strict;
use warnings;
my $seq = qw(GGGCCGGCTCGCGGGCGCTGCCAGTCTCGGGCGGCGGTGTCCGGCGCG
CGGGCGGCCTGCTGGGCGGGCTGAAGGGTTAGCGGAGCACGGGCAAGGCG
GAGAGTGACGGAGTCGGCGAGCCCCCGCGGCGACAGGTTCTCTACTTAAAA
GACAATGACTACTGATGAAGGTGCCAAGAACAATGAAGAAAGCCCCACAGC
CACTGTTGCTGAGCAGGGAGAGGATATTACCTCCAAAAAAGACAGGGGAGT
ATTAAAGATTGTCAAAAGAGTGGGGAATGGTGAGGAAACGCCGATGATTGG
AGACAAAGTTTATGTCCATTACAAAGGAAAATTGTCAAATGGAAAGAAGTTT
GATTCCAGTCATGATAGAAATGAACCATTTGTCTTTAGTCTTGGCAAAGGCC
AAGTCATCAAGGCATGGGACATTGGGGTGGCTACCATGAAGAAAGGAGAGA
TATGCCATTTACTGTGCAAACCAGAATATGCATATGGCTCGGCTGGCAGTCT
CCCTAAAATTCCCTCGAATGCAACTCTCTTTTTTGAGATTGAGCTCCTTGATT
TCAAAGGAGAGGATTTATTTGAAGATGGAGGCATTATCCGGAGAACCAAACG
GAAAGGAGAGGGATATTCAAATCCAAACGAAGGAGCAACAGTAGAAATCCA
CCTGGAAGGCCGCTGTGGTGGAAGGATGTTTGACTGCAGAGATGTGGCATT
CACTGTGGGCGAAGGAGAAGACCACGACATTCCAATTGGAATTGACAAAGC
TCTGGAGAAAATGCAGCGGGAAGAACAATGTATTTTATATCTTGGACCAAGA
TATGGTTTTGGAGAGGCAGGGAAGCCTAAATTTGGCATTGAACCTAATGCTG
AGCTTATATATGAAGTTACACTTAAGAGCTTCGAAAAGGCCAAAGAATCCTG
GGAGATGGATACCAAAGAAAAATTGGAGCAGGCTGCCATTGTCAAAGAGAA
GGGAACCGTATACTTCAAGGGAGGCAAATACATGCAGGCGGTGATTCAGTAT
GGGAAGATAGTGTCCTGGTTAGAGATGGAATATGGTTTATCAGAAAAGGAAT
CGAAAGCTTCTGAATCATTTCTCCTTGCTGCCTTTCTGAACCTGGCCATGTGC
TACCTGAAGCTTAGAGAATACACCAAAGCTGTTGAATGCTGTGACAAGGCCC
TTGGACTGGACAGTGCCAATGAGAAAGGCTTGTATAGGAGGGGTGAAGCCC
AGCTGCTCATGAACGAGTTTGAGTCAGCCAAGGGTGACTTTGAGAAAGTGCT
GGAAGTAAACCCCCAGAATAAGGCTGCAAGACTGCAGATCTCCATGTGCCAG
AAAAAGGCCAAGGAGCACAACGAGCGGGACCGCAGGATATACGCCAACATG
TTCAAGAAGTTTGCAGAGCAGGATGCCAAGGAAGAGGCCAATAAAGCAATGG
GCAAGAAGACTTCAGAAGGGGTCACTAATGAAAAAGGAACAGACAGTCAAGC
AATGGAAGAAGAGAAACCTGAGGGCCACGTATGACGCCACGCCAAGGAGGG
AAGAGTCCCAGTGAACTCGGCCCCTCCTCAATGGGCTTTCCCCCAACTCAGG
ACAGAACAGTGTTTAATGTAAAGTTTGTTATAGTCTATGTGATTCTGGAAGCA
AATGGCAAAACCAGTAGCTTCCCAAAAACAGCCCCCCTGCTGCTGCCCGGAG
GGTTCACTGAGGGGTGGCACGGGACCACTCCAGGTGGAACAAACAGAAATGA
CTGTGGTGTGGAGGGAGTGAGCCAGCAGCTTAAGTCCAGCTCATTTCAGTTT
CTATCAACCTTCAAGTATCCAATTCAGGGTCCCTGGAGATCATCCTAACAATG
TGGGGCTGTTAGGTTTTACCTTTGAACTTTCATAGCACTGCAGAAACCTTTTA
AAAAAAAATGCTTCATGAATTTCTCCTTTCCTACAGTTGGGTAGGGTAGGGGA
AGGAGGATAAGCTTTTGTTTTTTAAATGACTGAAGTGCTATAAATGTAGTCTG
TTGCATTTTTAACCAACAGAACCCACAGTAGAGGGGTCTCATGTCTCCCCAGT
TCCACAGCAGTGTCACAGACGTGAAAGCCAGAACCTCAGAGGCCACTTGCTT
GCTGACTTAGCCTCCTCCCAAAGTCCCCCTCCTCAGCCAGCCTCCTTGTGAGA
GTGGCTTTCTACCACACACAGCCTGTCCCTGGGGGAGTAATTCTGTCATTCCT
AAAACACCCTTCAGCAATGATAATGAGCAGATGAGAGTTTCTGGATTAGCTTT
TCCTATTTTCGATGAAGTTCTGAGATACTGAAATGTGAAAAGAGCAATCAGAA
TTGTGCTTTTTCTCCCCTCCTCTATTCCTTTTAGGGAATAATATTCAATACACA
GTACTTCCTCCCAGCATTGCTACTGCTCAGCTTCTTCTTTCATTCTAATCCTTG
CTATTAAGAATTTAAGACTTGTGCTTACAATATTTTTGACCTGGAGTGGATCT
ATTTACATAGTCATTTAGGATCCATGCAGCTTTTTTTGTCTTTTTAAGATTATT
GGCTCATAAGCATATGTATACTGGTTTATGGAACTTTATTTACACTCCTCTATC
ATGCAAAAAAATTTTGACTTTTTAGTACTAAGCTTAATTTTTAAAAACAAAATC
TGTAGTGTTGACAAATAAATAGTTGCTCTTCTACACTAGGGGTTTCACCTGCA
GGTTTGACACGCAGTTGCTCGCTTTTCCTGCCCTGTCAAGCTTCTCTGTTCTG
GCGTGAGTTGTGAAAGAGTTGAAGACAGCTTCCCATGCCGGTACACAGCCAG
TAGCCTAAATCTCCAGTACTTGAGCTGACCATTGAACTAGGGCAAGTCTTAAA
TGTGTACATGTAGTTGAATTTCAGTCCTTACGGGTAAACAGATTGAGCATGGC
TCTCTATTCCCTCAGCCTAAGAAACACTCATGGGAATGCATTTGGCAACCCAA
GGAACCATTTGCTTAAACCTGGAACATCTCACCTTTTTAAATCCTAAAAAACA
CTGGCAGTTATATTTTAAATTAGTTTTTATTTTTATGATGGTTTTATCAAAAGA
CTTTTATTATTAGATTGGGACCCCCTTCAAACCTAAAAATCAAGTTATTTCCTT
TTATAATACTTTTCTTCCCCATGGAACAAATGGGATCAATTTGTGAGTTTTTTC
CTTTAATGATAACTAAAATCCCTCTAATTTCTCATTTATGCTTTTGTCTTTTTTA
TGAAATATTTCTTTTAAAAGCCCCAGTCTCACCTACGAAATATGAAGAGCAAA
AGCTGATTTTGCTTACTTGCTAAACTGTTGGGAAAGCTCTGTAGAGCATGGTT
CCAGTGAGGCCAAGATTGAAATTTGATACTAAAAAGGCCACCTAGCTTTTTGC
AGATAACAAACAAGAAAGCTATTCCAAGACTCAGATGATGCCAGCTGTCTCCC
ACGTGTGTATTATGGTTCACCAGGGGGAACTGGCAAAAGTGTGTGTGGGGAG
GGGAAGGGTGTGTGAGTGGTTCTGAGCAAATAACTACAGGGTGCCCATTACC
ACTCAAGAAGACACTTCACGTATTCTTGTATCAAATTCAATAATCTTAAACAAT
TTGTGTAGAAGTCCACAGACATCTTTCAACCACCTTTTAGGCTGCATATGGAT
TGCCAAGTCAGCATATGAGGAATTAAAGACATTGTTTTTAAAAAAAAAAAATC
ATTTAGATGCACTTTTTTGTGTGTTCTTTAAATAAATCCAAAAAAAATGTGAAA
AAAAAAA);
my @x = split //, $seq;
my $exon_breaks= "0,133,257,402,545,660,817,908,992,1178,1418,3770";
my @y = split (/,/, $exon_breaks);
sub get_exon_sequence{
my @array = ($y[0]..$y[1]);
my $exon = join "", @x[@array];
print "$exon \n";
shift @y;
}
until($y[1] eq undef){&get_exon_sequence};
I want to join an array composed of sequence that I split based on position within the array. I spent the last two hours figuring out how to do this, and this is all I came up with. It works, but Jesus:
#!/usr/bin/perl
use strict;
use warnings;
my $seq = qw(GGGCCGGCTCGCGGGCGCTGCCAGTCTCGGGCGGCGGTGTCCGGCGCG
CGGGCGGCCTGCTGGGCGGGCTGAAGGGTTAGCGGAGCACGGGCAAGGCG
GAGAGTGACGGAGTCGGCGAGCCCCCGCGGCGACAGGTTCTCTACTTAAAA
GACAATGACTACTGATGAAGGTGCCAAGAACAATGAAGAAAGCCCCACAGC
CACTGTTGCTGAGCAGGGAGAGGATATTACCTCCAAAAAAGACAGGGGAGT
ATTAAAGATTGTCAAAAGAGTGGGGAATGGTGAGGAAACGCCGATGATTGG
AGACAAAGTTTATGTCCATTACAAAGGAAAATTGTCAAATGGAAAGAAGTTT
GATTCCAGTCATGATAGAAATGAACCATTTGTCTTTAGTCTTGGCAAAGGCC
AAGTCATCAAGGCATGGGACATTGGGGTGGCTACCATGAAGAAAGGAGAGA
TATGCCATTTACTGTGCAAACCAGAATATGCATATGGCTCGGCTGGCAGTCT
CCCTAAAATTCCCTCGAATGCAACTCTCTTTTTTGAGATTGAGCTCCTTGATT
TCAAAGGAGAGGATTTATTTGAAGATGGAGGCATTATCCGGAGAACCAAACG
GAAAGGAGAGGGATATTCAAATCCAAACGAAGGAGCAACAGTAGAAATCCA
CCTGGAAGGCCGCTGTGGTGGAAGGATGTTTGACTGCAGAGATGTGGCATT
CACTGTGGGCGAAGGAGAAGACCACGACATTCCAATTGGAATTGACAAAGC
TCTGGAGAAAATGCAGCGGGAAGAACAATGTATTTTATATCTTGGACCAAGA
TATGGTTTTGGAGAGGCAGGGAAGCCTAAATTTGGCATTGAACCTAATGCTG
AGCTTATATATGAAGTTACACTTAAGAGCTTCGAAAAGGCCAAAGAATCCTG
GGAGATGGATACCAAAGAAAAATTGGAGCAGGCTGCCATTGTCAAAGAGAA
GGGAACCGTATACTTCAAGGGAGGCAAATACATGCAGGCGGTGATTCAGTAT
GGGAAGATAGTGTCCTGGTTAGAGATGGAATATGGTTTATCAGAAAAGGAAT
CGAAAGCTTCTGAATCATTTCTCCTTGCTGCCTTTCTGAACCTGGCCATGTGC
TACCTGAAGCTTAGAGAATACACCAAAGCTGTTGAATGCTGTGACAAGGCCC
TTGGACTGGACAGTGCCAATGAGAAAGGCTTGTATAGGAGGGGTGAAGCCC
AGCTGCTCATGAACGAGTTTGAGTCAGCCAAGGGTGACTTTGAGAAAGTGCT
GGAAGTAAACCCCCAGAATAAGGCTGCAAGACTGCAGATCTCCATGTGCCAG
AAAAAGGCCAAGGAGCACAACGAGCGGGACCGCAGGATATACGCCAACATG
TTCAAGAAGTTTGCAGAGCAGGATGCCAAGGAAGAGGCCAATAAAGCAATGG
GCAAGAAGACTTCAGAAGGGGTCACTAATGAAAAAGGAACAGACAGTCAAGC
AATGGAAGAAGAGAAACCTGAGGGCCACGTATGACGCCACGCCAAGGAGGG
AAGAGTCCCAGTGAACTCGGCCCCTCCTCAATGGGCTTTCCCCCAACTCAGG
ACAGAACAGTGTTTAATGTAAAGTTTGTTATAGTCTATGTGATTCTGGAAGCA
AATGGCAAAACCAGTAGCTTCCCAAAAACAGCCCCCCTGCTGCTGCCCGGAG
GGTTCACTGAGGGGTGGCACGGGACCACTCCAGGTGGAACAAACAGAAATGA
CTGTGGTGTGGAGGGAGTGAGCCAGCAGCTTAAGTCCAGCTCATTTCAGTTT
CTATCAACCTTCAAGTATCCAATTCAGGGTCCCTGGAGATCATCCTAACAATG
TGGGGCTGTTAGGTTTTACCTTTGAACTTTCATAGCACTGCAGAAACCTTTTA
AAAAAAAATGCTTCATGAATTTCTCCTTTCCTACAGTTGGGTAGGGTAGGGGA
AGGAGGATAAGCTTTTGTTTTTTAAATGACTGAAGTGCTATAAATGTAGTCTG
TTGCATTTTTAACCAACAGAACCCACAGTAGAGGGGTCTCATGTCTCCCCAGT
TCCACAGCAGTGTCACAGACGTGAAAGCCAGAACCTCAGAGGCCACTTGCTT
GCTGACTTAGCCTCCTCCCAAAGTCCCCCTCCTCAGCCAGCCTCCTTGTGAGA
GTGGCTTTCTACCACACACAGCCTGTCCCTGGGGGAGTAATTCTGTCATTCCT
AAAACACCCTTCAGCAATGATAATGAGCAGATGAGAGTTTCTGGATTAGCTTT
TCCTATTTTCGATGAAGTTCTGAGATACTGAAATGTGAAAAGAGCAATCAGAA
TTGTGCTTTTTCTCCCCTCCTCTATTCCTTTTAGGGAATAATATTCAATACACA
GTACTTCCTCCCAGCATTGCTACTGCTCAGCTTCTTCTTTCATTCTAATCCTTG
CTATTAAGAATTTAAGACTTGTGCTTACAATATTTTTGACCTGGAGTGGATCT
ATTTACATAGTCATTTAGGATCCATGCAGCTTTTTTTGTCTTTTTAAGATTATT
GGCTCATAAGCATATGTATACTGGTTTATGGAACTTTATTTACACTCCTCTATC
ATGCAAAAAAATTTTGACTTTTTAGTACTAAGCTTAATTTTTAAAAACAAAATC
TGTAGTGTTGACAAATAAATAGTTGCTCTTCTACACTAGGGGTTTCACCTGCA
GGTTTGACACGCAGTTGCTCGCTTTTCCTGCCCTGTCAAGCTTCTCTGTTCTG
GCGTGAGTTGTGAAAGAGTTGAAGACAGCTTCCCATGCCGGTACACAGCCAG
TAGCCTAAATCTCCAGTACTTGAGCTGACCATTGAACTAGGGCAAGTCTTAAA
TGTGTACATGTAGTTGAATTTCAGTCCTTACGGGTAAACAGATTGAGCATGGC
TCTCTATTCCCTCAGCCTAAGAAACACTCATGGGAATGCATTTGGCAACCCAA
GGAACCATTTGCTTAAACCTGGAACATCTCACCTTTTTAAATCCTAAAAAACA
CTGGCAGTTATATTTTAAATTAGTTTTTATTTTTATGATGGTTTTATCAAAAGA
CTTTTATTATTAGATTGGGACCCCCTTCAAACCTAAAAATCAAGTTATTTCCTT
TTATAATACTTTTCTTCCCCATGGAACAAATGGGATCAATTTGTGAGTTTTTTC
CTTTAATGATAACTAAAATCCCTCTAATTTCTCATTTATGCTTTTGTCTTTTTTA
TGAAATATTTCTTTTAAAAGCCCCAGTCTCACCTACGAAATATGAAGAGCAAA
AGCTGATTTTGCTTACTTGCTAAACTGTTGGGAAAGCTCTGTAGAGCATGGTT
CCAGTGAGGCCAAGATTGAAATTTGATACTAAAAAGGCCACCTAGCTTTTTGC
AGATAACAAACAAGAAAGCTATTCCAAGACTCAGATGATGCCAGCTGTCTCCC
ACGTGTGTATTATGGTTCACCAGGGGGAACTGGCAAAAGTGTGTGTGGGGAG
GGGAAGGGTGTGTGAGTGGTTCTGAGCAAATAACTACAGGGTGCCCATTACC
ACTCAAGAAGACACTTCACGTATTCTTGTATCAAATTCAATAATCTTAAACAAT
TTGTGTAGAAGTCCACAGACATCTTTCAACCACCTTTTAGGCTGCATATGGAT
TGCCAAGTCAGCATATGAGGAATTAAAGACATTGTTTTTAAAAAAAAAAAATC
ATTTAGATGCACTTTTTTGTGTGTTCTTTAAATAAATCCAAAAAAAATGTGAAA
AAAAAAA);
my @x = split //, $seq;
my $exon_breaks= "0,133,257,402,545,660,817,908,992,1178,1418,3770";
my @y = split (/,/, $exon_breaks);
sub get_exon_sequence{
my @array = ($y[0]..$y[1]);
my $exon = join "", @x[@array];
print "$exon \n";
shift @y;
}
until($y[1] eq undef){&get_exon_sequence};
Wednesday, February 04, 2009
Lots of people that suck
So this semester I'm taking genomics, which is cool. But we have to learn perl. Which is also cool.
Except I have no programming experience, and this is a trial-by-fire if there ever was one.
Things are going well so far, I'm just so slow. Every day is an exercise in humility.
The good news? I'm talking to Alan a lot more. He's boss.
Here's a classical "alanism" from tonight:
I was happier than Nancy Grace after finding out that the Jon Benet Ramsey case was reopened.
Hvorostovsky did a program of Tchaikovsky, Medtner, and Rachmaninoff lied. I didn't really care for the Tchaikovsky, but the Medtner alone was worth the price of admission ($70).
His sublime legato made it seem like a ventriloquist was singing the consonants. A+.
Except I have no programming experience, and this is a trial-by-fire if there ever was one.
Things are going well so far, I'm just so slow. Every day is an exercise in humility.
The good news? I'm talking to Alan a lot more. He's boss.
Here's a classical "alanism" from tonight:
i'm starting to rethink that - the midwest has its perks,
like friends
normal life
green grass
lots of people that suck, so you look cooler.
****
I was happier than Nancy Grace after finding out that the Jon Benet Ramsey case was reopened.
Hvorostovsky did a program of Tchaikovsky, Medtner, and Rachmaninoff lied. I didn't really care for the Tchaikovsky, but the Medtner alone was worth the price of admission ($70).
His sublime legato made it seem like a ventriloquist was singing the consonants. A+.
Subscribe to:
Posts (Atom)